ID: 962384536

View in Genome Browser
Species Human (GRCh38)
Location 3:134922147-134922169
Sequence TCACTTCTGCTCTCAGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962384536 Original CRISPR TCACTTCTGCTCTCAGACAG TGG (reversed) Intronic
900717478 1:4154158-4154180 CATCTTCTGCTCTCAGACATTGG - Intergenic
900957769 1:5898161-5898183 TTACTTCAGCTCTCACACTGAGG + Intronic
902205415 1:14864811-14864833 TCACTTCCCCTCTCAGACCTTGG + Intronic
902251423 1:15156135-15156157 TCACTACTTCTCTCTGGCAGGGG - Intronic
902746208 1:18476302-18476324 TTACTTCTGCCCTCAGACAAGGG + Intergenic
903934865 1:26888581-26888603 TCACTTCTGCTCTGAAGCAGTGG - Intronic
905309249 1:37037997-37038019 GCACTTGTCCTTTCAGACAGCGG - Intergenic
905867704 1:41385227-41385249 TCTCTTCTCCTCTCAGCCAGTGG - Intergenic
905969431 1:42130158-42130180 TCATTTCTGATCTTAGACACTGG + Intergenic
906181280 1:43821758-43821780 GCACATCTGCTCTCTGAAAGGGG + Intronic
906339897 1:44970345-44970367 TGACTTCTGTTCTCAGACAAAGG - Intronic
906848212 1:49217925-49217947 TGACTTCTGATCACAGAAAGGGG - Intronic
907664914 1:56426232-56426254 TCAATTCTGGTCTCAGGAAGAGG - Intergenic
909287126 1:73834080-73834102 GAACTTCTTCTGTCAGACAGAGG - Intergenic
909517771 1:76531817-76531839 CCACTTCTGGACTCAGAAAGAGG + Intronic
911195371 1:94989427-94989449 TCACTTCTGCTGTGAGAAAGGGG - Intronic
915525972 1:156476508-156476530 TTATTTCTGCTCTCAGACTGAGG - Exonic
915850721 1:159319392-159319414 TCACTTCTGGTGTCGGACACAGG - Intergenic
916129966 1:161604482-161604504 TCACTGGTGCTCTCGGAGAGAGG + Intronic
916648799 1:166816356-166816378 TCTCTGCAGCTCTCAGAGAGAGG + Intergenic
918136463 1:181678395-181678417 TTGCTACTGCTCCCAGACAGTGG - Intronic
920751927 1:208686463-208686485 TCACTTCTGCTCCCTGGAAGTGG - Intergenic
923017783 1:230140176-230140198 TCATTCCTCCTCTCAGGCAGAGG - Intronic
1062978704 10:1704103-1704125 TCACTCTTGCTGTAAGACAGCGG + Intronic
1066372885 10:34832195-34832217 TCACTTCTGCTTTCAAATATGGG + Intergenic
1072738662 10:97896563-97896585 CCCCTTCTGCTCTCAGGCAGAGG - Intronic
1073379362 10:103066221-103066243 TCCCTGCTGCTCTCAGTCACGGG + Intronic
1074422866 10:113324751-113324773 TCACTTCTGCTCACATTCATTGG - Intergenic
1074665784 10:115721843-115721865 TCAGGTCTGCTACCAGACAGAGG - Intronic
1075098987 10:119492745-119492767 TCACTTCTCCACTGACACAGTGG + Intergenic
1075832099 10:125420072-125420094 TCACTTCTGTTCTCCCACTGAGG + Intergenic
1077337382 11:2011445-2011467 TCACTTCCGCTCCCAGTGAGTGG - Intergenic
1077779963 11:5316700-5316722 TCCCTGCTTCTCCCAGACAGAGG - Intronic
1077925758 11:6681017-6681039 TTACTTATTATCTCAGACAGTGG + Exonic
1078668640 11:13346205-13346227 TCACTTCTGCCCTCATTCACTGG + Intronic
1080191815 11:29559633-29559655 TGACATTTGCTCTCTGACAGAGG + Intergenic
1080564420 11:33495044-33495066 TAACTTCTGATCTCTGAAAGTGG - Intergenic
1081298833 11:41425442-41425464 TCACTTCTTTACTCAGCCAGAGG - Intronic
1082054943 11:47806226-47806248 TCACCTCTTCTCTCAGCCAAAGG - Exonic
1085021146 11:73209231-73209253 TCAATTCAGGTCACAGACAGAGG + Intergenic
1085722128 11:78921765-78921787 TCACTTGTGATCTCAGACTGAGG + Intronic
1086901846 11:92376365-92376387 TCAGTTCTGGTTTCAGACAGAGG + Intronic
1088035164 11:105302820-105302842 TCAGTTCAGCTCCCAGACAATGG + Intergenic
1088170542 11:106991373-106991395 TCACTACTGCTCTAAGCCAATGG + Intronic
1089342189 11:117765471-117765493 ACACTGCTGCTCTTACACAGAGG - Intronic
1090481833 11:127075776-127075798 TAACTTCTGTTCTCTGAGAGAGG - Intergenic
1091298660 11:134490612-134490634 ACACTTCTGCTCACAGGCATTGG + Intergenic
1091298667 11:134490661-134490683 ACACTTCTGCTTACAGGCAGTGG + Intergenic
1091298731 11:134491249-134491271 ACACTTCTGCTTACAGGCAGTGG + Intergenic
1091298767 11:134491543-134491565 ACACTTCTGCTCACAGTCAGTGG + Intergenic
1202820366 11_KI270721v1_random:66627-66649 TCACTTCCGCTCCCAGTGAGTGG - Intergenic
1091605272 12:1946347-1946369 CCAGTTCAGCTCTAAGACAGAGG - Intronic
1093147173 12:15580736-15580758 TCATTTCTGGTTTCAGGCAGTGG - Exonic
1096401416 12:51309843-51309865 ACACATCTGCTCTTAGAGAGAGG + Intronic
1100077460 12:90802948-90802970 TCGCGTCTGCTCTCACACTGTGG - Intergenic
1103813711 12:123636292-123636314 TTCCTTCTGCTCTGAGATAGGGG + Intronic
1104267980 12:127254813-127254835 TATCTTCTGCTCACAGAAAGTGG - Intergenic
1104315122 12:127691440-127691462 TCACCTCTGCTCTTGGAGAGTGG - Intergenic
1104704974 12:130937131-130937153 TCTTCTCTGCTCTCAGACATGGG - Intergenic
1105709252 13:22990314-22990336 TCACTGCTTCTCCCAGAGAGAGG - Intergenic
1109155752 13:58906759-58906781 ACACTTCTGCTCTAAGAATGTGG + Intergenic
1110397593 13:75049591-75049613 TTTCTCCTGCTCTCAGACACTGG + Intergenic
1110968033 13:81725893-81725915 TCAGGCCTGCTCTCATACAGAGG + Intergenic
1111868587 13:93801370-93801392 TCATATCTGCTTTCTGACAGTGG + Intronic
1114206954 14:20581132-20581154 TTACTTCTGCTCACAGAGACTGG + Intergenic
1114353305 14:21878577-21878599 TCACTTCTGTTTGGAGACAGAGG - Intergenic
1114979677 14:28147373-28147395 ACACTTCTGCCCTGAGACACTGG - Intergenic
1116868715 14:50051991-50052013 TCTCTTCTCCTTTCAGAGAGTGG + Intergenic
1117504544 14:56389071-56389093 TCACTTCTGCCCTATCACAGTGG - Intergenic
1118277449 14:64398114-64398136 ACAATTCTGCTCTGAGACAAGGG - Intronic
1118686404 14:68295674-68295696 TCCCTTCTGCTCTGATGCAGAGG - Intronic
1118773167 14:68955863-68955885 TCACTTTTGCTCTAAGTCATGGG + Intronic
1122627947 14:103093858-103093880 CCACCTCTGCCCTCAGCCAGAGG + Intergenic
1124254934 15:28132588-28132610 TCACTGCTGCTGTCAGATGGGGG - Intronic
1125612842 15:40983863-40983885 TCACTGCTGCTCTCGTCCAGGGG + Exonic
1126065685 15:44824692-44824714 TCACCTCTGCACTCAGTCACTGG + Intergenic
1126094150 15:45075875-45075897 TCACCTCTGCACTCAGTCACTGG - Exonic
1127196950 15:56597523-56597545 ACACTGCTGCTCTGAGACTGAGG + Intergenic
1127980621 15:64032398-64032420 TCACTGCAGCACTGAGACAGAGG - Intronic
1128305275 15:66594316-66594338 TCACTGGTGCTCACAGCCAGGGG + Intronic
1128730565 15:70018027-70018049 CCACATCTGCTCTCAGTCACAGG - Intergenic
1130905609 15:88238975-88238997 GCAGTTCTCCACTCAGACAGTGG + Intronic
1133854327 16:9535399-9535421 ACACCTCTGCTCTGAGACTGAGG - Intergenic
1135125382 16:19805152-19805174 GCACTTCCGTTCTCAGGCAGGGG + Intronic
1135851651 16:25969251-25969273 TCTCTTTTGCTCTCATACTGTGG + Intronic
1137553265 16:49454829-49454851 TCACTGCTGCTCTCTGTTAGTGG - Intergenic
1137802852 16:51277034-51277056 TCTCTGCTGCTGTCAGACATTGG + Intergenic
1139470552 16:67175937-67175959 TCACAGCTGCTCTCTGGCAGAGG - Exonic
1141286890 16:82681009-82681031 TCATTTGTGCTCTGAGACACTGG - Intronic
1141790796 16:86232750-86232772 CCACAGCTGCTCTGAGACAGCGG + Intergenic
1142928182 17:3259525-3259547 TCCTTTCAGCTCTGAGACAGCGG + Intergenic
1143239385 17:5431036-5431058 TCACTGCTGCTCTGAGCCACAGG - Intronic
1144086135 17:11810260-11810282 TCACTCCAGCTTTCAGACACAGG - Exonic
1144812083 17:18006953-18006975 TCCCTGATGCTCTCAGACGGCGG - Intronic
1144877531 17:18409526-18409548 TCATTTATTCTGTCAGACAGTGG - Intergenic
1145111081 17:20162105-20162127 TCACTTCTGCCCTCAGACTTCGG + Intronic
1146778163 17:35640763-35640785 TAACTACTGCTCTAAGCCAGTGG - Intronic
1148446338 17:47739982-47740004 TCACCTCTGCTCTCCCACCGAGG + Intronic
1149425369 17:56549730-56549752 TCACAGCTGCTCTCAGTCAAAGG + Intergenic
1150604615 17:66680310-66680332 TCGCTTTTGCTGTCAGGCAGGGG + Intronic
1150611303 17:66735641-66735663 GCACTCCTGCTTCCAGACAGTGG + Exonic
1151376555 17:73692959-73692981 TGGGTTCAGCTCTCAGACAGGGG - Intergenic
1155726443 18:29091010-29091032 TCACCTCTGCTCTCAGGGAGAGG + Intergenic
1156066184 18:33146273-33146295 AAACTTCTGCTTTCAGACTGAGG - Intronic
1157799410 18:50606816-50606838 TCACTTCTGCTCACACACATTGG - Intronic
1160576045 18:79854250-79854272 CCACTGCTGCCCTCACACAGGGG - Intergenic
1162534503 19:11254799-11254821 CCACTTCTGAGCTCAGCCAGAGG - Intronic
1162606259 19:11710447-11710469 TCCCTTCTGCTCACACACTGAGG + Intergenic
1163784887 19:19269934-19269956 CCACTTCTGTTCTTGGACAGAGG - Intronic
1163930907 19:20390853-20390875 TAAATTTTGCTCTCAGAAAGGGG + Intergenic
1164887748 19:31797388-31797410 GCACTTCTAGTCTCACACAGTGG + Intergenic
1164952519 19:32349291-32349313 TCCATTCTGCTCTCTGTCAGAGG - Intronic
1164974851 19:32564775-32564797 TGGCTTTTGTTCTCAGACAGTGG - Intergenic
1167593343 19:50415871-50415893 TCACTTCTGCTTTCCGAGATGGG + Intronic
1167773810 19:51541757-51541779 CTCCTTCTGCTCTCAGACTGGGG + Intergenic
924975422 2:169735-169757 TCAATTCTGCTTTTAGAAAGGGG + Intergenic
925365915 2:3312095-3312117 GCACTTCAGTTATCAGACAGAGG - Intronic
925504378 2:4544416-4544438 TCACATCTGGTTTCAGACACTGG - Intergenic
926125920 2:10271861-10271883 TCAGTTGTGCGCTCAGACAGTGG + Intergenic
928294851 2:30073644-30073666 CCACTTCTGATCAAAGACAGGGG + Intergenic
929827855 2:45323552-45323574 TCACTTCCTCTCTCAGCCTGTGG - Intergenic
930934163 2:56927005-56927027 TCAATACTGCTTTAAGACAGTGG + Intergenic
932411393 2:71549938-71549960 TCACCTCCCCTCTCAGCCAGGGG - Intronic
933312719 2:80680628-80680650 TCACTTCAGCTCTCTGCCTGGGG + Intergenic
933892448 2:86784121-86784143 TCTCTTCTGCTTTCACACATAGG + Intergenic
934634698 2:95973677-95973699 CCACTTCTGCTCCCAAACAGTGG + Intronic
934798937 2:97131559-97131581 CCACTTCGGCTCCCAAACAGTGG - Intronic
934834499 2:97571908-97571930 CCACTTCTCCTCCCAAACAGTGG + Intronic
936549311 2:113421647-113421669 TCACTTCAGCTGTCAGAATGAGG - Intergenic
937262949 2:120598029-120598051 GCACTTATGCTCACAGCCAGTGG - Intergenic
939834046 2:147106398-147106420 TCTCTTCTGCCTTCAGACATTGG - Intergenic
940184572 2:150969235-150969257 ACACTTCTGCTTTAAGACAGGGG + Intergenic
941913678 2:170792859-170792881 CCATTTCTGCTCTCAGAAACTGG - Exonic
942286368 2:174421493-174421515 TCCCTGCTGCTCTCAGTCACTGG - Intronic
942659904 2:178253326-178253348 TGACTTCTGCTCATATACAGTGG - Intronic
945960706 2:216131777-216131799 TCACCTTTCCTCTCACACAGTGG + Intronic
947509765 2:230741039-230741061 TCACTGCTCCTCTCAGAGTGTGG - Intronic
1168956102 20:1835558-1835580 TCACTTCTGCTCACAGATCTTGG + Intergenic
1169601780 20:7269408-7269430 TCACTTCTGGTCTCAGGCTGGGG - Intergenic
1169863470 20:10175304-10175326 TCACTTGCACTTTCAGACAGAGG - Intergenic
1170283387 20:14677365-14677387 TCTATCCCGCTCTCAGACAGTGG + Intronic
1170414831 20:16128527-16128549 TCACTACAGCTCTCAGACACTGG + Intergenic
1174755818 20:53157730-53157752 TTACTTCTGCTTTTAGAGAGAGG + Intronic
1175488857 20:59365233-59365255 TCACTTCCCCCCTCTGACAGGGG + Intergenic
1175581606 20:60104199-60104221 TCACACCGGCTGTCAGACAGAGG - Intergenic
1177153858 21:17482024-17482046 TCACTTCTGCTCTTAGACCCAGG - Intergenic
1177921146 21:27154119-27154141 TCGCTTCTGCTACCAGCCAGAGG - Intergenic
1178121391 21:29473727-29473749 GGGCTTCTGCTCACAGACAGAGG - Intronic
1179303294 21:40132224-40132246 CCACTTCAGCTCTCATACACTGG + Intronic
1180966217 22:19789208-19789230 TCTCTGCTGCTCTCTGACTGGGG - Intronic
1180984916 22:19898480-19898502 CCACCTGTGCTCTCAGCCAGCGG + Intronic
1181315513 22:21968510-21968532 ACACTTCTGCCCTCAGCCCGGGG + Intronic
1181638095 22:24183556-24183578 TCACCTCTGCTCTATGAGAGCGG + Exonic
1183344787 22:37301268-37301290 TTACTCCTGCCCTCAGAAAGGGG - Intronic
949512595 3:4779782-4779804 TCACTTCTCTACTCAGTCAGAGG - Intronic
951044372 3:18022033-18022055 TCACGTTAGTTCTCAGACAGTGG - Intronic
951549998 3:23867724-23867746 TCTCCTTTGCTCTCAGACATGGG - Intronic
957514552 3:81233710-81233732 TCTCTTCTGCCCTCAGACATCGG - Intergenic
958174185 3:89974337-89974359 TCACTTCTCATCTCAGACCCTGG + Intergenic
959587073 3:108034643-108034665 TGAATTCTGCTCACAGCCAGAGG - Intergenic
959618608 3:108375809-108375831 TCCATTCTTCTCTCAGACATGGG - Intronic
960034027 3:113085164-113085186 TCACTTGACCTCCCAGACAGTGG - Intergenic
961317735 3:126052039-126052061 TCCTTTCTGCTCTCAGACCAAGG + Intronic
961558284 3:127711479-127711501 ACACTTCTGCCTTCAGAGAGGGG + Intronic
962384536 3:134922147-134922169 TCACTTCTGCTCTCAGACAGTGG - Intronic
962825831 3:139100462-139100484 TCACTTCTTCCTTCAGACTGTGG + Intronic
963271747 3:143291950-143291972 ACACCTCTGCTCTAAGCCAGTGG + Intronic
965467438 3:169047933-169047955 TCACTTCTGCACTCAGAGGTAGG + Intergenic
967846796 3:194050324-194050346 TTACTACTGTTCTCAGACATTGG + Intergenic
969606352 4:8204096-8204118 GCACTTTTGCTCCCAGACAGAGG + Intronic
971705427 4:30036147-30036169 TCACTTCTCCTCTCATACGTGGG - Intergenic
971716764 4:30187853-30187875 TCACTTGTGATCTCAGAAAGAGG + Intergenic
973920661 4:55681694-55681716 TCACTTCTGCTATGTGACATTGG - Intergenic
976541781 4:86285877-86285899 CCTCTTCTGCCCTCAGACATTGG - Intronic
977160932 4:93634070-93634092 TCACTTCTGCTCTCAGAGCTTGG - Intronic
984585195 4:181555825-181555847 TCACTTCTGCTCACATACTATGG + Intergenic
985100406 4:186452704-186452726 TGGCTTCAGTTCTCAGACAGTGG + Intronic
985318867 4:188686925-188686947 TCACAGCAGCTCTTAGACAGTGG + Intergenic
985721288 5:1490557-1490579 GCACTTCTGCTTTTAGACGGCGG + Intronic
988065164 5:26223032-26223054 TCACTTCTCTTCTCCTACAGAGG - Intergenic
988343082 5:30000318-30000340 TCACTTCTTCTCTCTGGCATAGG + Intergenic
989220889 5:38961779-38961801 TTACTACTGATCTCAGAAAGAGG - Intronic
990850145 5:60193913-60193935 TCACTCATCCTCTCAGACAGCGG - Intronic
994537354 5:101048734-101048756 TCACTTGTTCATTCAGACAGGGG - Intergenic
995113945 5:108458183-108458205 TGACTTCTGCCCCCTGACAGAGG + Intergenic
999634041 5:153601536-153601558 TCACTTTTGCTTTTAGACATGGG - Intronic
1000289696 5:159858920-159858942 GGACTTCTTCTCTCAGCCAGTGG + Intergenic
1000463075 5:161546563-161546585 TTACCTCTGCGCACAGACAGCGG + Exonic
1000743713 5:165003325-165003347 AATCTTCTGCTCTCAGACATAGG - Intergenic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1006593299 6:35173907-35173929 TCCCTCCTGCTCTCCGCCAGGGG + Intergenic
1008813108 6:55529292-55529314 TCACTTCTGCTTTCATGCATGGG - Intronic
1009353522 6:62710214-62710236 TCACTGCTGCTCTGTCACAGTGG - Intergenic
1014325286 6:119986187-119986209 ACACTTCTGCTTTATGACAGAGG + Intergenic
1016920707 6:149290222-149290244 GGACTTCTCCTCTCAGACAAGGG - Intronic
1018966659 6:168495329-168495351 TCACTTCCTCTCTCAGCCACTGG + Intronic
1019895362 7:3978065-3978087 TCCTTTCGGGTCTCAGACAGAGG + Intronic
1020465562 7:8474967-8474989 GCATTTCTGCTCTCAGACCTGGG - Intronic
1021136870 7:16975789-16975811 TCACATCTACTCTCTGAGAGTGG + Intergenic
1022879355 7:34569895-34569917 TCACTTCTGTTACCAGAAAGGGG + Intergenic
1024673816 7:51620397-51620419 TCACTACTTTTCTCAAACAGTGG - Intergenic
1029869402 7:103674505-103674527 GCACATCTGCTCCCAGTCAGTGG - Intronic
1035006532 7:155666285-155666307 TATCTTCTGCCCTCAGACATGGG - Intronic
1035313625 7:157984637-157984659 TCAGTCCTGCTCTCTGACACCGG + Intronic
1036004139 8:4642803-4642825 AAACATTTGCTCTCAGACAGAGG - Intronic
1036153922 8:6324597-6324619 TCATTTCTGCTCTCCTACATTGG - Intergenic
1038179080 8:25209778-25209800 TCACTTCTACTCTCAACAAGAGG + Intronic
1038706690 8:29900789-29900811 TTACTTCTGCCCAAAGACAGAGG + Intergenic
1039461084 8:37744938-37744960 TCACTTCTGGCCTCAATCAGAGG + Intronic
1045150277 8:99398711-99398733 TCATTTCTTCTTTAAGACAGAGG + Intronic
1047347521 8:124042608-124042630 TCACTTCTGCGCTAACACAGAGG + Intronic
1048337951 8:133516994-133517016 TCACTTCTGCTCAGAGAAAGTGG - Intronic
1048389566 8:133948508-133948530 TCACTTCTTCTCTCAGGATGTGG - Intergenic
1048814342 8:138317865-138317887 CCACTGCTGCCCTCACACAGAGG - Intronic
1049052163 8:140207083-140207105 TCTCTTCAGCTCTCAGGAAGCGG + Intronic
1049903628 9:195190-195212 TCACTTCAGCTGTCAGAATGAGG + Intergenic
1050321673 9:4458908-4458930 CCACTTCTGCTCTAGCACAGTGG - Intergenic
1051138445 9:13950859-13950881 TCAATTCTGCTCACAGTCAGTGG + Intergenic
1051688225 9:19681087-19681109 TGACTTCTGCTCTGAGATAGGGG - Intronic
1052158605 9:25226677-25226699 TCACTTCTGCAGTCCGACAAAGG + Intergenic
1052604795 9:30686091-30686113 TCTCCTCTGCTATCAGACAGAGG + Intergenic
1054480627 9:65659725-65659747 TCACTTCAGCTGTCAGAATGAGG - Intergenic
1054681707 9:68225782-68225804 TCACTTCAGCTGTCAGAATGAGG - Intergenic
1055834083 9:80418912-80418934 TCCCTGCTGCCCTCAGTCAGGGG - Intergenic
1059450220 9:114366976-114366998 TCACTTCTGTTTTCAGAATGTGG + Intronic
1059899500 9:118907489-118907511 TCACTGAGGCTCTCAGAGAGAGG + Intergenic
1060734233 9:126056182-126056204 TTACTTCTGCACACAGACATAGG - Intergenic
1060793929 9:126502486-126502508 TAACTCCTGCCCCCAGACAGGGG + Intronic
1202782768 9_KI270718v1_random:16279-16301 TCACTTCAGCTGTCAGAATGAGG + Intergenic
1185672058 X:1820760-1820782 TCACTACTGCTCTCATGCGGTGG - Intergenic
1186387522 X:9125166-9125188 TTACTTCTGATCTGATACAGAGG - Intronic
1186570761 X:10712688-10712710 TCACTTCTGCTCTCAAAATGTGG + Intronic
1187302551 X:18065129-18065151 GGACTTCTGCTCTATGACAGAGG - Intergenic
1188271111 X:28141806-28141828 TTAACTCTGCTCTCAAACAGTGG + Intergenic
1188601439 X:31970688-31970710 TAACGCCTGCTCTCATACAGTGG - Intronic
1188617995 X:32182175-32182197 GCATTTCAGCTCTCTGACAGTGG - Intronic
1189351837 X:40281336-40281358 TCACTGCAGCTGCCAGACAGAGG - Intergenic
1190507926 X:51145891-51145913 TCAGTTCTGCTCTGTCACAGTGG - Intergenic
1197795638 X:130295229-130295251 TGATTTCTGCTCTTAGACACAGG + Intergenic
1198045296 X:132895759-132895781 TCACTTCTGCTTGCTGACACTGG + Intronic
1200204322 X:154304819-154304841 TAACTGCTGCTCTTAGAAAGCGG - Intronic
1201796383 Y:17901008-17901030 ATACTTTTTCTCTCAGACAGTGG - Intergenic
1201805172 Y:18004977-18004999 ATACTTTTTCTCTCAGACAGTGG + Intergenic
1201947122 Y:19523250-19523272 TCCCTTCTGCTCACAGGCAGTGG + Intergenic
1202357778 Y:24070074-24070096 ATACTTTTTCTCTCAGACAGTGG - Intergenic
1202513000 Y:25600039-25600061 ATACTTTTTCTCTCAGACAGTGG + Intergenic