ID: 962384828

View in Genome Browser
Species Human (GRCh38)
Location 3:134924114-134924136
Sequence TAATTTCTGCATAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20542
Summary {0: 1, 1: 5, 2: 279, 3: 9367, 4: 10890}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962384828_962384835 25 Left 962384828 3:134924114-134924136 CCTTCCACCTTATGCAGAAATTA 0: 1
1: 5
2: 279
3: 9367
4: 10890
Right 962384835 3:134924162-134924184 GAAAAAAATCTTTGTGACCTTGG 0: 1
1: 30
2: 152
3: 419
4: 1400
962384828_962384836 26 Left 962384828 3:134924114-134924136 CCTTCCACCTTATGCAGAAATTA 0: 1
1: 5
2: 279
3: 9367
4: 10890
Right 962384836 3:134924163-134924185 AAAAAAATCTTTGTGACCTTGGG 0: 4
1: 37
2: 131
3: 416
4: 1306
962384828_962384832 1 Left 962384828 3:134924114-134924136 CCTTCCACCTTATGCAGAAATTA 0: 1
1: 5
2: 279
3: 9367
4: 10890
Right 962384832 3:134924138-134924160 CTTGAACCATAGACCTAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 67
962384828_962384831 -3 Left 962384828 3:134924114-134924136 CCTTCCACCTTATGCAGAAATTA 0: 1
1: 5
2: 279
3: 9367
4: 10890
Right 962384831 3:134924134-134924156 TTAACTTGAACCATAGACCTAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962384828 Original CRISPR TAATTTCTGCATAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr