ID: 962385874

View in Genome Browser
Species Human (GRCh38)
Location 3:134932262-134932284
Sequence CTGAATGCACAGCTGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962385868_962385874 17 Left 962385868 3:134932222-134932244 CCTGATACGAGCTACATGCCCAT 0: 1
1: 0
2: 0
3: 4
4: 36
Right 962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG 0: 1
1: 0
2: 3
3: 32
4: 245
962385871_962385874 -1 Left 962385871 3:134932240-134932262 CCCATGAGTGCCGGTGCGCAGGC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG 0: 1
1: 0
2: 3
3: 32
4: 245
962385872_962385874 -2 Left 962385872 3:134932241-134932263 CCATGAGTGCCGGTGCGCAGGCT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG 0: 1
1: 0
2: 3
3: 32
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962385874 Original CRISPR CTGAATGCACAGCTGCTGCT TGG Intronic
900115987 1:1028126-1028148 CTCAATGCACAGCTCCTTCCCGG - Intronic
900569404 1:3351006-3351028 CTGTCTGCAGAGCTGCTGGTTGG + Intronic
900609118 1:3537042-3537064 CTGAATGCAGAGCTAGTGTTGGG + Intronic
901012874 1:6211057-6211079 CTGGAGCCACTGCTGCTGCTGGG + Exonic
901052386 1:6431775-6431797 CTGATTACATAGCTACTGCTCGG - Intronic
901179329 1:7330359-7330381 CTGACGGTGCAGCTGCTGCTGGG + Intronic
901314311 1:8295468-8295490 CGTCAGGCACAGCTGCTGCTGGG + Intergenic
901792038 1:11658762-11658784 CTGAACGCACAGCTGGTACTTGG - Exonic
902329785 1:15725602-15725624 CTGGATGAACAGCTGATGCTGGG - Intronic
902481851 1:16716244-16716266 CTGATTACATAGCTACTGCTCGG + Intergenic
903373506 1:22851836-22851858 CTGTGTGCAGGGCTGCTGCTGGG - Intronic
904046921 1:27614731-27614753 CTGGAGGCACAGCTGATGCAGGG + Intronic
904295955 1:29519887-29519909 CTGAACACACGGCTGCTGCCGGG - Intergenic
904410407 1:30321644-30321666 CTGAACAAGCAGCTGCTGCTAGG + Intergenic
904878798 1:33678531-33678553 GTGAATGAACAGCTGCTGCAGGG + Intronic
907563859 1:55416508-55416530 CTGTAGGCTCAGCTGCTGGTGGG - Intergenic
908998975 1:70195756-70195778 CTGTAAGTCCAGCTGCTGCTCGG - Intronic
909475930 1:76080871-76080893 CTGAATTCTCAGCAGCTGCCTGG + Intronic
910234735 1:85023906-85023928 CAGTATTCAAAGCTGCTGCTAGG + Intronic
910447058 1:87309540-87309562 CTGAATGCACAGCAGCAGGCAGG - Intergenic
915488496 1:156238717-156238739 CTGAAGGCCCTGCTGCAGCTTGG + Intronic
915658355 1:157380502-157380524 CCCAATGAACAGCTCCTGCTGGG + Intergenic
915812614 1:158930707-158930729 CTGCTTGCAGATCTGCTGCTGGG + Intergenic
915819690 1:159008941-159008963 CTGCTTGCAGATCTGCTGCTGGG + Intronic
915831925 1:159139345-159139367 CTGAATGCTCAGCCCCTGCCTGG - Intronic
920033747 1:203052310-203052332 ATGAACTCACAGCTGCTTCTCGG - Intronic
921084967 1:211781543-211781565 CTGACTGCCAAGCAGCTGCTTGG + Intronic
922516634 1:226212847-226212869 CTGAATGGACGCCTGCTGCGAGG + Intergenic
922974166 1:229769757-229769779 CTGTCTCCCCAGCTGCTGCTTGG - Intergenic
1063391472 10:5652545-5652567 CTGGGTGCAGAGCTGCTGCTTGG - Intronic
1065005205 10:21373294-21373316 CTGAATGCTTAGCTGGGGCTGGG - Intergenic
1067947919 10:50702332-50702354 CTGAGTGTCCAGCTGCTGCTGGG + Intergenic
1069609873 10:69766017-69766039 CTAAGTGCTCAGCTGCTGATGGG + Intergenic
1069613762 10:69793043-69793065 CTGCCTTCACAGCTACTGCTGGG + Intergenic
1070883233 10:79867329-79867351 CTGAGCGTCCAGCTGCTGCTGGG + Intergenic
1071451288 10:85793292-85793314 CTGGATGGACAGCAGCTGCTAGG - Intronic
1071649801 10:87383636-87383658 CTGAGCGTCCAGCTGCTGCTGGG + Intergenic
1073721652 10:106179631-106179653 TTGAATGGACAGCAGCTGTTGGG + Intergenic
1074604579 10:114948554-114948576 GTGAATGAAAAGCTGCTGGTTGG + Intronic
1075172005 10:120124289-120124311 CTGACTCCACAGATTCTGCTTGG + Intergenic
1076019037 10:127055329-127055351 TGGAATGCAGAGCTGATGCTGGG - Intronic
1076047513 10:127306426-127306448 CTGAATGGACTGTTGATGCTTGG + Intronic
1076627430 10:131830694-131830716 CTGAAGGAACAGCCGCTGCCCGG - Intergenic
1077459482 11:2701482-2701504 CTGGTTGCACAGCTGCCTCTCGG - Intronic
1077564752 11:3290506-3290528 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1077570642 11:3336323-3336345 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1078641194 11:13098340-13098362 CTGATTGCACAACGGCTGCCAGG + Intergenic
1081495679 11:43607967-43607989 CTGAGTGCACAGCTCCTGTCTGG + Intronic
1082074147 11:47963266-47963288 CTGTCTGCACATCTGCTTCTTGG - Intergenic
1082085856 11:48048987-48049009 CAGAGAGCACAGTTGCTGCTTGG + Intronic
1083297335 11:61722053-61722075 CTGGATGCAGACCAGCTGCTGGG + Intronic
1083855374 11:65390582-65390604 CTTCCTGCTCAGCTGCTGCTGGG + Intronic
1083904903 11:65663035-65663057 CTGCACGCACAGCCGCTGCCGGG + Exonic
1088395355 11:109361920-109361942 CTGAATGGACAGCTCAAGCTAGG + Intergenic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1089074168 11:115724741-115724763 CTGATGCCACAGCTGCTGCTGGG + Intergenic
1090998732 11:131890299-131890321 CTGAATCTACAAATGCTGCTAGG + Intronic
1092853986 12:12655979-12656001 CTTAATCTACAGCTGCTTCTGGG + Intergenic
1093077879 12:14775470-14775492 ATGAAAGCACAGCAGCTACTAGG - Intronic
1093493104 12:19726519-19726541 CTGGGTTCACAGCTGCTGTTTGG + Intergenic
1095970190 12:47896539-47896561 CTGAATGCCAAGCTCCTGCGTGG - Intronic
1097309801 12:58105870-58105892 CTGAATGTAGAACTGCTTCTGGG + Intergenic
1097900123 12:64864435-64864457 TGGAATGCCCAGCTGCAGCTGGG + Intronic
1098670735 12:73227255-73227277 CTGGATTCACACATGCTGCTAGG + Intergenic
1102529401 12:113534985-113535007 CTGAGTGCAGAGCTGCGGGTTGG + Intergenic
1102977701 12:117218415-117218437 CTGGAAACACCGCTGCTGCTTGG + Intronic
1104799344 12:131543013-131543035 CTGAATTCACTGCTGCTTGTGGG + Intergenic
1104918815 12:132279944-132279966 CTGAATGCCCAGTGTCTGCTAGG + Intronic
1107337463 13:39370289-39370311 TTGAATTCACAGCAGCTGCTTGG + Intronic
1107820487 13:44281335-44281357 CTGCATGCAGAGCTGGTCCTGGG + Intergenic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1108863478 13:54892309-54892331 CTGCATGCACAGTTTCTACTTGG + Intergenic
1109326105 13:60869809-60869831 GTGCAAGGACAGCTGCTGCTGGG + Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1112033033 13:95474620-95474642 CTGAATACACAGCTTCTTCTTGG - Intronic
1113849581 13:113410556-113410578 CAGGACGCACAGCTGCTCCTTGG - Intergenic
1116997379 14:51337743-51337765 CTGAGGGCACAGCTCCTGCTTGG - Intergenic
1117907795 14:60608690-60608712 CTGAATGTTCAGCTTCTCCTTGG + Intergenic
1119669217 14:76506101-76506123 CTGAAGCCACAGGTGCTGCCTGG - Intergenic
1120338545 14:83189962-83189984 CAGGAAGCACAGCAGCTGCTGGG - Intergenic
1122475831 14:102008275-102008297 CTGTATGCACTGCACCTGCTGGG - Exonic
1122690146 14:103528434-103528456 CTGAGTGCAGAGCTGCTTCTAGG - Intergenic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1126142514 15:45449862-45449884 CTGAAGGAACAGCACCTGCTAGG + Intergenic
1127023349 15:54775709-54775731 CTGCAACCCCAGCTGCTGCTGGG - Intergenic
1127283348 15:57510889-57510911 CTGTTTGTACAGCTGCTCCTGGG + Intronic
1130606087 15:85318313-85318335 CTGGAAGCACACCTGCTCCTAGG - Intergenic
1132236437 15:100225408-100225430 CTGCATGAATGGCTGCTGCTGGG - Intronic
1132506076 16:309747-309769 CTGAATGAACAGCTCCCTCTGGG + Intronic
1133262194 16:4558178-4558200 CTGAAGGCCCAGCAGCTGGTGGG + Intronic
1134281265 16:12819118-12819140 CTGTAATCCCAGCTGCTGCTAGG + Intergenic
1134886358 16:17796125-17796147 CTGAATTCACAACTGCTTCCAGG + Intergenic
1135848486 16:25940761-25940783 CTGAATGCAAACCTTCTGCCTGG - Intronic
1136024943 16:27463163-27463185 CTGAATGCCCAGCTGCCCCCGGG - Intronic
1136030735 16:27500963-27500985 ATGCCTGCACAGCTGCTGCTTGG + Intronic
1137676460 16:50305968-50305990 GAGAATCCACAGCTGCTCCTGGG + Intronic
1138446332 16:57066545-57066567 CTGGACACAGAGCTGCTGCTGGG - Exonic
1139536688 16:67579914-67579936 CTGGATGCAGATCTGCTGATAGG + Intronic
1139747934 16:69089446-69089468 CTGAGGTCAAAGCTGCTGCTGGG - Intergenic
1140641671 16:76980900-76980922 CTGAATGTAGAGTTGCTGCTTGG + Intergenic
1140753352 16:78046023-78046045 CTGAGGGCAGTGCTGCTGCTTGG + Intronic
1141234419 16:82202147-82202169 GTGCCTGCTCAGCTGCTGCTTGG - Intergenic
1141592316 16:85077204-85077226 CTCAGTGCACAGCAGGTGCTGGG + Intronic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142346492 16:89557404-89557426 CTGAATGCTCTGCTGCCTCTGGG - Exonic
1143109370 17:4544817-4544839 CTGGATACGCAGCTTCTGCTCGG + Exonic
1143982230 17:10879932-10879954 TTGCATGCAAAGTTGCTGCTAGG - Intergenic
1144019927 17:11231741-11231763 CTGAATGTCCAGCTGCTCCCTGG - Intergenic
1144642300 17:16944244-16944266 CAGCATGTACAGGTGCTGCTAGG - Intronic
1144947718 17:18978274-18978296 CTGCTTCCACAGCTGGTGCTGGG + Exonic
1146316413 17:31810686-31810708 CTGAACGCAAAGCCTCTGCTTGG - Intergenic
1148951854 17:51320269-51320291 CTGAATGGACTGCTGCCTCTTGG - Intergenic
1150945994 17:69746113-69746135 CGGACTGCACAGCTAGTGCTGGG + Intergenic
1151447080 17:74174002-74174024 TGGAATGCACTGCTGCTGCTCGG - Intergenic
1151975436 17:77481421-77481443 CTGGATGCAGAGCTGTTCCTGGG - Intronic
1152426242 17:80220225-80220247 CGGAACGCACTGCTGCTCCTCGG - Exonic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1153677783 18:7470753-7470775 CTGAATGTGCAGCTCCTTCTTGG + Intergenic
1154309115 18:13254023-13254045 GTCAATGCAGACCTGCTGCTGGG + Intronic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1157574066 18:48732107-48732129 GTGAATGCACTGCTGCAGCATGG - Intronic
1157933977 18:51854047-51854069 CTGAATCCACAGCTGCTATCAGG - Intergenic
1158497891 18:57973201-57973223 CAGAATGCACAGGTGCTGTGGGG + Intergenic
1159999245 18:75001085-75001107 CTGAAAGCTCAGCTTCTGGTGGG - Intronic
1160800678 19:966648-966670 CTGCTTGCACAGCTGCTGCCTGG - Exonic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1161927992 19:7315669-7315691 CTGAGTTTACAGCTGCTGCCTGG - Intergenic
1162596007 19:11629831-11629853 GTGATTGCACAGCTGATGTTTGG - Intergenic
1162805315 19:13135265-13135287 CTCAATGAACAGCGGCTGCAGGG + Exonic
1163129963 19:15266152-15266174 CTGCCTGCACAGCTGCTGGGAGG - Intronic
1163294536 19:16403799-16403821 CTGAATGCTCTGCTCCAGCTGGG + Exonic
1164984344 19:32637689-32637711 CTGGATCCAGAGCTGCGGCTGGG - Intronic
1165173995 19:33913947-33913969 CTCAATGCCCAGCTCCTGCTAGG + Intergenic
1165379759 19:35470402-35470424 CTGAATTCTCAGCCTCTGCTAGG + Intergenic
1168388052 19:55982575-55982597 CTGACTCCACAGTTGGTGCTGGG + Intronic
926326419 2:11788162-11788184 CTGCTGGCACGGCTGCTGCTGGG + Intronic
927883362 2:26704304-26704326 CTGAATGCACAGCTTCTGCATGG + Intronic
928002011 2:27531582-27531604 CAGGAAGCACAGCAGCTGCTGGG - Intergenic
929893562 2:45938561-45938583 CTGAATAAATAGCTGCTGCAAGG - Intronic
930089151 2:47519405-47519427 CAGTATGCACAGCTTCTGATAGG - Exonic
933230477 2:79801563-79801585 CCGTATGCACTGCTACTGCTGGG - Intronic
933719935 2:85391348-85391370 CTGAAAGCCCTGCTGCTGCCAGG - Exonic
935575423 2:104704847-104704869 CTGAATGCAAACCTGCTCCCTGG - Intergenic
938605911 2:132892429-132892451 CTGAAAGCACATCTGGTGGTGGG - Intronic
940422929 2:153499876-153499898 CTGGGTGCACAGCTGCGGCTGGG + Intergenic
941699119 2:168585202-168585224 CTGAATGAACAGCACCTGCCTGG + Intronic
941843248 2:170109835-170109857 CTGGATGCTGAGCTCCTGCTGGG + Intergenic
942469442 2:176244447-176244469 TTCAATGCAAGGCTGCTGCTGGG + Intergenic
942664490 2:178303029-178303051 CAGAATGCACAGACACTGCTCGG - Intronic
946334806 2:219029583-219029605 CTCAATCCACAGGGGCTGCTCGG + Exonic
948897227 2:240933123-240933145 CTGCAGGCACAGCTCCTGCTCGG - Intronic
949055111 2:241923460-241923482 TTGACTGCACAGCCGCTGCAGGG - Intergenic
949055132 2:241923613-241923635 TTGACTGCACAGCCGCTGCAGGG - Intergenic
1169741307 20:8897770-8897792 CTGGGTGGTCAGCTGCTGCTTGG - Intronic
1171052213 20:21870670-21870692 CTGACTGCAAAGCAACTGCTGGG - Intergenic
1173026498 20:39312218-39312240 CTGAATGGACAGTGGCTGCCTGG - Intergenic
1173370662 20:42432006-42432028 CTGACAGCATGGCTGCTGCTGGG + Intronic
1173958400 20:47052460-47052482 CGGATTGCTCAGCTACTGCTGGG + Intronic
1175413360 20:58785815-58785837 CTGTATGCCCAGCTCATGCTAGG + Intergenic
1176163813 20:63662569-63662591 ATGGATGCACAGCTGCTCCCGGG - Exonic
1178471601 21:32898561-32898583 GTGAAAGAACTGCTGCTGCTGGG - Intergenic
1179867348 21:44225415-44225437 CTGCATGGACAGCTGCAGCCTGG + Intronic
1179941447 21:44641061-44641083 CTGCATCCAGAGCTGATGCTGGG - Intronic
1180065609 21:45410730-45410752 CTGCCAGCACAGCTGCTCCTGGG + Intronic
1180248232 21:46562598-46562620 CAGAAGGCACAGCTGCTGTGAGG + Intronic
1181132201 22:20738605-20738627 CTGAATGACCACGTGCTGCTGGG + Intronic
1181937435 22:26448978-26449000 CTGAACCCACCGCTGCTCCTGGG - Intronic
1182854775 22:33507273-33507295 CTGAATGGGCATCTGGTGCTGGG + Intronic
1183452805 22:37906076-37906098 CTGGAGGCGGAGCTGCTGCTGGG + Intronic
1183580937 22:38726306-38726328 CTGAATGACACGCTGCTGCTGGG + Exonic
1183927043 22:41213696-41213718 CTGAATGAAGTGCTGCTGCTTGG - Intronic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
949982399 3:9509964-9509986 CTGAAGACCCAGCTGCTGCTAGG + Intronic
950102524 3:10366739-10366761 CTGAAAGCTCAGCTGTGGCTCGG + Intronic
950942917 3:16911868-16911890 CTGAAAGCAAAGGTGCTGTTAGG - Intronic
952901117 3:38112285-38112307 GTCAATGCACAGCTGCTGGTAGG - Exonic
953215765 3:40916458-40916480 CAGAATACACAGTTGCTCCTGGG - Intergenic
954409709 3:50365112-50365134 CTGGCTGCACAGCGGCTTCTCGG + Exonic
958034218 3:88150501-88150523 CTGAAGAGTCAGCTGCTGCTCGG + Intronic
959664126 3:108902626-108902648 CTGAAGGAGCAGCTGCTGATTGG + Intergenic
960640339 3:119817130-119817152 CTGGATGCGCAGCAGCCGCTGGG - Exonic
961357112 3:126346189-126346211 CTGTGTGCCCAGCTGCAGCTGGG - Intronic
961786707 3:129351922-129351944 CAGAATGTCCCGCTGCTGCTGGG + Intergenic
962068336 3:132007347-132007369 CTGACTCCAGAGTTGCTGCTTGG - Intronic
962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG + Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
965731322 3:171774979-171775001 CTGAAGGAGCAGCTGCAGCTGGG + Intronic
968489706 4:883431-883453 CTGACTCCACACCTTCTGCTGGG + Exonic
968762751 4:2450951-2450973 CTGAAGCCGCAGCTGCTGCTTGG - Exonic
971529665 4:27670644-27670666 CTGAAGGCCCAGCTGATACTTGG + Intergenic
976375203 4:84338542-84338564 CTGCATGCACACATGCTGGTAGG + Intergenic
978761013 4:112356548-112356570 GTGGATGCACAGCTGCTCCCGGG - Intronic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
984003060 4:174274147-174274169 CTGAAAGAGCAGCTGCAGCTGGG - Intronic
984325086 4:178241603-178241625 CTGGGTCCACAGCTGCGGCTTGG - Intergenic
985309834 4:188585672-188585694 CTGGATGCTCAGATTCTGCTGGG + Intergenic
985638694 5:1053031-1053053 CAGAATGCACAGCTGCTGTGGGG + Intronic
985752864 5:1692319-1692341 CGGAGTGCACAGGTGCTGGTAGG + Intergenic
985970936 5:3377824-3377846 CTGCATGCTGAGCTGCTTCTTGG + Intergenic
987220279 5:15783976-15783998 CTGAGTGCTCACCTGCTGATAGG - Intronic
988503119 5:31799681-31799703 CTGAATGGGCAGCTGATGGTTGG + Exonic
989039583 5:37213605-37213627 CAAAATGCAAAGCTGCTGATTGG + Exonic
990624452 5:57595856-57595878 CATTATGCACAGCAGCTGCTTGG + Intergenic
991449694 5:66738751-66738773 CTGAATACTCAGCTGCTGTCAGG + Intronic
993450015 5:88061767-88061789 CTGAATCCAAAGATGCTGCAAGG + Intergenic
994881368 5:105501485-105501507 CCAGCTGCACAGCTGCTGCTAGG - Intergenic
994955431 5:106525359-106525381 CTGAATGGACAGGTCCTCCTGGG - Intergenic
996014144 5:118512628-118512650 CTAAAGGGGCAGCTGCTGCTTGG - Intergenic
998146434 5:139731708-139731730 CTGAAGGCCCAGCTGCTCCCAGG - Intergenic
998417510 5:141956505-141956527 CTGAATGCTGAGCTGTTTCTTGG + Exonic
998690706 5:144584461-144584483 CTGAAGTGACAGATGCTGCTGGG - Intergenic
1001047108 5:168382611-168382633 GGGAATCCACAGCTGCTGATGGG + Intronic
1001403189 5:171458581-171458603 CAGAAGGCACCTCTGCTGCTGGG + Intergenic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1002638819 5:180620967-180620989 CTGGATGCTCAGCTTCTGGTTGG + Exonic
1004272240 6:14205950-14205972 CTGAAGTCACTGCTGCTGCATGG - Intergenic
1004550657 6:16644119-16644141 ATGAATGCAGAGCTTCTGTTCGG + Intronic
1005251606 6:23952443-23952465 GTAAATCCTCAGCTGCTGCTTGG - Intergenic
1006977709 6:38119061-38119083 CTGAATGCCCAGCTGACTCTAGG - Intronic
1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG + Intergenic
1007650333 6:43415966-43415988 CACCATGCCCAGCTGCTGCTGGG + Intergenic
1008174028 6:48244197-48244219 ATAATTGCAAAGCTGCTGCTAGG + Intergenic
1012752662 6:103183735-103183757 CTGACTTCACAGCTGCAACTTGG - Intergenic
1012939320 6:105400857-105400879 CGCAATGCCCAGCTGATGCTGGG + Intronic
1017087901 6:150731158-150731180 CTAAATGCACGGCTGCTGATTGG + Intronic
1017637693 6:156459290-156459312 TTAAAAGCACAGCTGTTGCTGGG + Intergenic
1017910082 6:158785042-158785064 CTGACTGCTCAGCTCCTCCTGGG - Intronic
1018862474 6:167721006-167721028 CTGAACTCACAGCGGGTGCTGGG - Intergenic
1019485970 7:1289325-1289347 TTGGACGCACAGCTTCTGCTAGG - Intergenic
1020631108 7:10640699-10640721 CTGAAGGAACAGCTGCTAGTTGG + Intergenic
1021795314 7:24248758-24248780 CTGAAGACACAGCATCTGCTAGG - Intergenic
1023142710 7:37118208-37118230 CTTAATGCACAGAGGCTACTTGG + Intronic
1023489796 7:40726771-40726793 CTGACTGCACAGGTGCTGCTTGG + Intronic
1024267020 7:47614628-47614650 TGGAAAGCACTGCTGCTGCTTGG - Intergenic
1024397755 7:48888776-48888798 TTCACTCCACAGCTGCTGCTGGG + Intergenic
1024702413 7:51918468-51918490 CTGAATAAACAGCTGGTGTTTGG - Intergenic
1028477155 7:91265064-91265086 CTGGAGGCTCCGCTGCTGCTGGG + Exonic
1031323792 7:120366360-120366382 CTGTATTCTCAGCTGCTACTTGG + Intronic
1033217589 7:139504709-139504731 CAGGACACACAGCTGCTGCTTGG + Intergenic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1039417218 8:37406071-37406093 CTGAATTGACAGCTTCTGCCGGG + Intergenic
1039469797 8:37806260-37806282 CTGAGTGCACAGTGGCTGTTAGG + Intronic
1040459380 8:47632792-47632814 CTGAAAGGCCAGCTACTGCTCGG - Intronic
1041868653 8:62607333-62607355 CTGAATGCACACCCCCTGCTGGG + Intronic
1042007919 8:64203198-64203220 ATGAATACACATCTGGTGCTTGG - Intergenic
1043962648 8:86434742-86434764 CTGAATGCATAGCTGGTACCTGG - Intronic
1044257899 8:90087266-90087288 CTGAATGGCCAGCTTCTACTGGG + Intronic
1044683255 8:94802698-94802720 CTGATTGCACCACTGCAGCTTGG - Intergenic
1044806200 8:96010789-96010811 CTCAAGCCACAGCTGCTTCTTGG + Intergenic
1045971035 8:108080645-108080667 CTTAATGCAGAGATGCTGTTTGG - Intronic
1046576730 8:116039309-116039331 CTGAATGGACAGTTGCCTCTTGG - Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1049050683 8:140192550-140192572 CTGACTGCACAGCTGGTGCGAGG - Intronic
1049876185 8:145022859-145022881 TTGCAGTCACAGCTGCTGCTAGG - Intergenic
1050206239 9:3199416-3199438 CTGAATGCACAGTCCTTGCTGGG - Intergenic
1050810075 9:9733911-9733933 ATGAATACAAAGCTGCTGTTTGG + Intronic
1052679442 9:31670466-31670488 CTTAATGCAAATCTGGTGCTGGG - Intergenic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1055741400 9:79393551-79393573 CTGAATGGACAGGTGATGCAGGG - Intergenic
1056575101 9:87850373-87850395 CTGAGGGTCCAGCTGCTGCTGGG - Intergenic
1058838048 9:108877052-108877074 TGGAAGGAACAGCTGCTGCTGGG - Intronic
1061096491 9:128460211-128460233 TGGAATGCACAGCTCCTCCTTGG - Intronic
1061331124 9:129894035-129894057 CCGAATGTGCAGCTACTGCTTGG + Intronic
1061614502 9:131771008-131771030 CAGAAAGCACAGGTGCTGCAGGG + Intergenic
1062227814 9:135463457-135463479 GCCAATGCACAGCTGCTGCTGGG + Intergenic
1062246068 9:135566783-135566805 CTGGATGCGCAGCCACTGCTGGG + Exonic
1062536546 9:137023617-137023639 CTAAAGGCACAGCTGGTGCCTGG - Intronic
1186316937 X:8381213-8381235 CTGATTGAACAGCTGCGGTTGGG + Intergenic
1187956952 X:24528539-24528561 CTGAATGCATAGCTGCCGCTTGG + Intronic
1193650146 X:84122191-84122213 CTCACTGCATGGCTGCTGCTGGG - Intronic
1195263075 X:103153080-103153102 CAGGAAGCACAGCTGCTTCTTGG - Intergenic
1197604814 X:128573251-128573273 TTGACAGCACAGCTTCTGCTAGG + Intergenic
1198262383 X:134976397-134976419 TTGCCAGCACAGCTGCTGCTTGG - Intergenic
1198774206 X:140162358-140162380 CTGAGTGCTCAGCAGCTCCTTGG - Intergenic
1199325084 X:146489907-146489929 CAAAGTGCACAGCTGCTGCCAGG - Intergenic
1199393169 X:147305707-147305729 CCAAGTGCACAGCTGTTGCTGGG - Intergenic