ID: 962386291

View in Genome Browser
Species Human (GRCh38)
Location 3:134935150-134935172
Sequence GCACTGGGATGGAGCTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 473}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962386283_962386291 12 Left 962386283 3:134935115-134935137 CCAGGGCAGGAGAGGACACAGGG 0: 1
1: 1
2: 8
3: 80
4: 632
Right 962386291 3:134935150-134935172 GCACTGGGATGGAGCTGAGGAGG 0: 1
1: 0
2: 3
3: 41
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962386291 Original CRISPR GCACTGGGATGGAGCTGAGG AGG Intronic
900295327 1:1946397-1946419 GCACCTTGATGGAGCTGAAGGGG + Exonic
900428519 1:2591495-2591517 CCACTGGGGTGGGGGTGAGGGGG + Intronic
900595482 1:3478370-3478392 GCACTGGGTAGGAGCTGGGTGGG + Intronic
901527709 1:9834563-9834585 ACACTGGGATGGAGCAGTGGCGG + Intergenic
901536366 1:9884910-9884932 GCACTGGGGTGGGGCTGCGGTGG + Intronic
901628765 1:10638369-10638391 GCCCTGGGGTGGGGCTGAGCTGG + Exonic
901919939 1:12528651-12528673 GCACTGGGATGGACCGGTGGGGG - Intergenic
902511409 1:16968922-16968944 GCAATGGGATGGGGCCCAGGTGG + Intronic
902749381 1:18496619-18496641 GCACTTTGAGGGGGCTGAGGTGG + Intergenic
903797514 1:25940902-25940924 GCATTGGGGTGGAGCTCAGAAGG + Intergenic
904478521 1:30779644-30779666 GAACTGGGTTGGCGGTGAGGAGG + Intergenic
905191451 1:36238213-36238235 GCACTCTGAGGAAGCTGAGGTGG - Intronic
905625617 1:39489177-39489199 GGACTGGAAGGGAACTGAGGTGG - Intergenic
906699309 1:47846376-47846398 GCAGTGAGAAGGAGCTGATGTGG + Intronic
906984295 1:50666452-50666474 GCACTTTGAGGGGGCTGAGGTGG - Intronic
907328230 1:53654605-53654627 GGACTGGGAAGAAGCGGAGGGGG + Intronic
907447833 1:54520258-54520280 GCCCTGAGATGGAGGTGAAGAGG + Intergenic
907588676 1:55645191-55645213 GCTCTTGGAAGGAGCTGGGGTGG + Intergenic
908423368 1:63981295-63981317 GGACAGGGCAGGAGCTGAGGAGG - Intronic
909710680 1:78645992-78646014 GCACAGGGGTGGAGGTGGGGGGG + Exonic
914440808 1:147704631-147704653 GCACTGGGATGGAACTCATTAGG + Intergenic
914751611 1:150538515-150538537 GCACAGGGTTGGAGGTGGGGCGG - Intergenic
915141343 1:153770504-153770526 GCTCTGGGCTGGGGCTCAGGTGG + Intronic
915460836 1:156069886-156069908 GCACTGGGGAGGGACTGAGGGGG - Intronic
915659152 1:157388111-157388133 GGACTGGGCTGCAGCTGAGATGG - Intergenic
916588108 1:166165895-166165917 GCAGTAGGAAGGAGCTGGGGAGG + Intronic
917757827 1:178120734-178120756 GATCTGAGGTGGAGCTGAGGTGG - Intronic
918398615 1:184141907-184141929 GCACTGGGATGGGGAGGAGACGG - Intergenic
918628326 1:186684257-186684279 ATACTCTGATGGAGCTGAGGGGG - Intergenic
919765944 1:201127405-201127427 GCTCTGGGCTGGAGCCTAGGAGG + Intergenic
919795630 1:201319883-201319905 GCCTTGGGATGCAGCTGCGGAGG + Intronic
919902731 1:202056138-202056160 GGACCGGGATGGAGCAGGGGAGG + Intergenic
919934665 1:202243635-202243657 AAGCCGGGATGGAGCTGAGGAGG + Intronic
920458238 1:206117046-206117068 GGACTGGGATAGAGAGGAGGAGG + Exonic
921819835 1:219604568-219604590 GCAATGGGAGGGACCTGAAGGGG + Intergenic
922128213 1:222750301-222750323 TCACAGGGGTGGAGTTGAGGTGG - Exonic
922467410 1:225853704-225853726 GCAATGGCATGGAGCTGCTGCGG - Exonic
922917426 1:229270555-229270577 CCTCTTGGATGGAGCTGAGCGGG - Intergenic
923048113 1:230370121-230370143 GGACGGGGATGGAGCTGCAGGGG + Intronic
923104114 1:230841285-230841307 GCACTGATGTGGAGCCGAGGTGG + Intronic
923634567 1:235682210-235682232 GGTCGGGGATGGGGCTGAGGTGG + Intronic
923781855 1:237031960-237031982 GCACTTGTAGGGAGCTGAAGAGG - Intergenic
924933676 1:248750461-248750483 GCACCGGGAGGGAGCTGGAGAGG - Intronic
1063594359 10:7420304-7420326 GATCTGAGATGGAGCTGATGTGG + Intergenic
1065875056 10:29990430-29990452 CCACTGGGAAGGAGTAGAGGAGG + Intergenic
1066065813 10:31760114-31760136 GCTTCGGGGTGGAGCTGAGGGGG + Intergenic
1068699765 10:60007318-60007340 GAACTGAAATGGAGCTGAAGTGG - Intergenic
1068805528 10:61190652-61190674 GCACTTTGGGGGAGCTGAGGCGG - Intergenic
1069550126 10:69358359-69358381 GCACTGGGGTGGGCCTCAGGGGG - Intronic
1069621543 10:69840519-69840541 GCACTGTGAAGCTGCTGAGGTGG - Intronic
1070553166 10:77507420-77507442 GCTCTGGGATGGGGCAGTGGGGG - Intronic
1070572127 10:77648121-77648143 GCACTGCCTGGGAGCTGAGGTGG + Intergenic
1070683515 10:78465490-78465512 GGGCTGGGCTGGAGGTGAGGGGG + Intergenic
1070805242 10:79266968-79266990 ACAGTGGAATGGGGCTGAGGAGG + Intronic
1070982371 10:80659960-80659982 GCACTGGGCAGGAGCTTAGCAGG - Intergenic
1071016101 10:80998657-80998679 GCAGTGGGATGAAGGAGAGGGGG + Intergenic
1071954916 10:90747580-90747602 GCACTGGGATTCAGATGATGTGG + Intronic
1072249757 10:93572309-93572331 GCAAGGGGATGGAGACGAGGAGG + Intronic
1072550031 10:96470196-96470218 GCTCAGGGATGGAGCTGGGCAGG - Intronic
1072853773 10:98925087-98925109 GCTAGGGGATGGAGGTGAGGTGG + Intronic
1073179271 10:101574132-101574154 GCGCTTGGATGGAGTTGGGGAGG - Intronic
1073376826 10:103042327-103042349 GCCCTGGGAAAGGGCTGAGGCGG - Intronic
1074114767 10:110447439-110447461 GCCCTGGGATGGGAATGAGGAGG - Intergenic
1074185331 10:111096189-111096211 GCACTGTGATAGACCTCAGGTGG - Intergenic
1074413539 10:113247693-113247715 GCAGTGGGCTGGAGCACAGGGGG + Intergenic
1075470227 10:122683263-122683285 GCAAAGAGATGGAGCTGAGCAGG - Intergenic
1075500217 10:122966002-122966024 GAACTGGGCTGAAGCTGAGAAGG + Intronic
1075899182 10:126025180-126025202 GAACTGGGCTGGGGCTGAGATGG + Intronic
1076190436 10:128479559-128479581 GCACTGAGATGGGCCTGGGGTGG - Intergenic
1076292971 10:129361736-129361758 GCTCTGGGATGATGCTGGGGAGG - Intergenic
1076496281 10:130899765-130899787 GCAGTGGGTTGAAGCTGGGGTGG + Intergenic
1077092872 11:787634-787656 GCAGTGGGACGGACCTGGGGTGG - Exonic
1077307649 11:1875159-1875181 GCACTGGGCTGGTGCCGTGGAGG + Intronic
1077476968 11:2795098-2795120 GCTGTGGGGTGGAGCTGAGTGGG - Intronic
1077993633 11:7434015-7434037 GCCCTGTGCTGTAGCTGAGGTGG - Intronic
1078067213 11:8086341-8086363 GTGCTGGGGTGGAGATGAGGAGG + Intronic
1078396454 11:10986138-10986160 GCAATGGGACGGGGCTGAGGAGG - Intergenic
1078514609 11:12010872-12010894 GGACTGGCATGGAGCTGGGCAGG - Intergenic
1078549851 11:12272485-12272507 GCACAGGCCTGGATCTGAGGAGG + Intergenic
1079240167 11:18716867-18716889 TCAATGGGAAGGAGCTGAAGAGG - Exonic
1081545396 11:44067843-44067865 GTTCTGGGATTCAGCTGAGGAGG + Exonic
1083214858 11:61212091-61212113 GCAATGGGATGGGGCTGCGGGGG + Intronic
1083217742 11:61230920-61230942 GCAATGGGATGGGGCTGCGGGGG + Intronic
1083220738 11:61250670-61250692 GCAATGGGATGGGGCTGCGGGGG + Intronic
1083263930 11:61537558-61537580 GCACCAGGAGGGAGCTGGGGAGG - Intronic
1083742030 11:64716287-64716309 GGACTGGGATGGGGGTGGGGCGG - Intronic
1083882455 11:65555295-65555317 ACACAGGGAAGGAGCAGAGGGGG - Intronic
1084060697 11:66671992-66672014 GCACTTTGAGGGGGCTGAGGCGG - Intronic
1084410399 11:69003239-69003261 GCACTGGGAGGGAGCGGGTGGGG + Intergenic
1085019340 11:73195375-73195397 GCACTGGGATAGACATGGGGCGG + Intergenic
1085335040 11:75687141-75687163 GAACTGGGCTGAAGCTGAGATGG - Intergenic
1085410087 11:76285708-76285730 GCACAGGGCAGGAGCTCAGGAGG - Intergenic
1086050013 11:82578154-82578176 GAACTGGGATGGGGCTGACATGG + Intergenic
1087020566 11:93598653-93598675 GCACTGGAAAGGAGGGGAGGGGG - Intergenic
1088559235 11:111096181-111096203 GCACTGGGATAGAACTGATGGGG + Intergenic
1089482756 11:118820540-118820562 GCACAGGGATGGGCCTGAGATGG - Intergenic
1089491750 11:118888288-118888310 GGACTGGGCAGAAGCTGAGGGGG - Intronic
1090007469 11:123015872-123015894 GCAATGAGATGAAGCTGTGGTGG - Intergenic
1090501471 11:127265397-127265419 GATATGGGATGGAGCTGGGGTGG + Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091356470 11:134941586-134941608 GGACCGGGATGGCGGTGAGGAGG - Intergenic
1091600728 12:1916203-1916225 GCAGGGGGAATGAGCTGAGGAGG + Intronic
1092888007 12:12942302-12942324 AGACAGTGATGGAGCTGAGGAGG - Exonic
1094501567 12:31025867-31025889 GCTCTGGGATACAGCTAAGGCGG + Intergenic
1095942642 12:47736939-47736961 CCTCTGGGAAGGAGCTGTGGAGG - Intronic
1096199672 12:49672711-49672733 GCAGTGGGAAGGAAATGAGGAGG - Intronic
1096637922 12:52973134-52973156 GCACTGGGATGAGGAGGAGGCGG - Intergenic
1096865004 12:54557401-54557423 GCACTGGGTTAGAGCTGATTTGG + Intronic
1097643091 12:62205473-62205495 TCACTGGGATGGAACTGCTGAGG - Intronic
1097666001 12:62477751-62477773 GCGCAGGAATGGAGGTGAGGTGG - Intronic
1098830079 12:75350828-75350850 GAACTGGGATGAGGCTGAGATGG + Intronic
1099369598 12:81812780-81812802 GAACTGGGCTGAGGCTGAGGTGG + Intergenic
1100359335 12:93861730-93861752 AGTCTGGGATGGAGCTGAGTGGG - Intronic
1101706832 12:107228382-107228404 GCAGTGGGATTGAGATGAGAAGG - Intergenic
1101727232 12:107398153-107398175 GCATTGGGTTGGGGCTGGGGTGG + Intronic
1101845231 12:108358186-108358208 GCACTGGGCTGGGGGTGAAGTGG + Intergenic
1101998334 12:109540939-109540961 GCGGTGGGCGGGAGCTGAGGTGG + Intergenic
1102392186 12:112558088-112558110 GCCCTGGGAAGGAGCAGAGTGGG + Intergenic
1103403615 12:120659766-120659788 GCACTGGGTAGGAGGTGACGAGG - Intronic
1103452482 12:121039060-121039082 GCACTGGAGGGCAGCTGAGGAGG - Exonic
1103523120 12:121549400-121549422 GGACAGGGAAGGAGATGAGGTGG + Intronic
1103961474 12:124611661-124611683 GCGCTGGGATGGTGCTGGGAGGG - Intergenic
1103961478 12:124611672-124611694 GCGCTGGGATGGCGCTGGGATGG - Intergenic
1104356879 12:128094800-128094822 GCACTGGGTTGGAACAGAGTAGG - Intergenic
1104485541 12:129148753-129148775 GCCCTGGCATGCAGCTGTGGAGG - Intronic
1105520605 13:21127510-21127532 GCTCTGGGAAGGGGCTGAGATGG - Intergenic
1107837367 13:44422807-44422829 GCAATGGGTAGGAGGTGAGGGGG - Intergenic
1107911427 13:45108932-45108954 GCACTGGGGTGGAGCTACAGAGG - Intergenic
1110048097 13:70856982-70857004 GCACAGGCATGGAGCAGAGCTGG - Intergenic
1112454298 13:99544519-99544541 GCACTGGGCTGGAGATGAACAGG + Intronic
1112865526 13:103891906-103891928 GACATGGGATGGAGCTCAGGTGG - Intergenic
1113811349 13:113144334-113144356 CCAGTGGGAAGGGGCTGAGGGGG - Intronic
1114266957 14:21078304-21078326 GGATTGGGATGGGGCTGGGGTGG + Intronic
1114515339 14:23296041-23296063 GCACTGTGAAGGAACTGAGGAGG + Exonic
1115103803 14:29735666-29735688 GCACTGGAATGGTGCTGAGCTGG - Intronic
1115310621 14:31974832-31974854 GCTCAGGGATGGAGGTGGGGGGG - Intergenic
1115385336 14:32789852-32789874 GAACTGGGTTGGGGCTGAGATGG + Intronic
1115967926 14:38912711-38912733 GAACTGGGATGAGGCTGAGATGG + Intergenic
1118280120 14:64420657-64420679 GCACGGGGATAGATCTGAGTGGG - Intronic
1118896564 14:69950198-69950220 GCACAGGGATGGAGCAGCTGAGG - Intronic
1119058595 14:71449701-71449723 GCTCAGGGTTGGAGGTGAGGTGG + Intronic
1119311678 14:73652146-73652168 GAACTGGGCAGGGGCTGAGGCGG - Intronic
1120141062 14:80930125-80930147 GACCTGAGGTGGAGCTGAGGTGG + Intronic
1120603478 14:86542074-86542096 GCCCTGAGATGTAGCTGAGTTGG - Intergenic
1121181799 14:91934827-91934849 GAACTGGGATGGAAGAGAGGTGG - Intronic
1121307658 14:92917186-92917208 GCCCTGGGAAGGAGAGGAGGTGG + Intergenic
1122045986 14:99024078-99024100 CCACTGTCATGGAGTTGAGGTGG - Intergenic
1122214600 14:100194462-100194484 GCACTGGGCTGGGGCTTTGGTGG + Intergenic
1122721977 14:103727377-103727399 GCACGGGGACGGGGCGGAGGGGG - Intronic
1123063268 14:105603996-105604018 TAAATGGGATTGAGCTGAGGAGG - Intergenic
1123087330 14:105722782-105722804 TAAATGGGATTGAGCTGAGGAGG - Intergenic
1123457216 15:20436985-20437007 GCCCTGGGATGGAGGGGAGGAGG + Intergenic
1123660842 15:22563374-22563396 GCCCTGGGATGGAGGGGAGGAGG - Intergenic
1123884970 15:24717866-24717888 GAACTGGGCTGAAGCTGAGATGG - Intergenic
1124209063 15:27747177-27747199 GCACTGGCATGAGGCTGGGGTGG - Intergenic
1124263369 15:28212134-28212156 GCCCTGGGATGGAGAGGAGGAGG + Intronic
1124314644 15:28657612-28657634 GCCCTGGGATGGAGGGGAGGAGG - Intergenic
1124620611 15:31271949-31271971 ACACTGGGCTGGGGCTGGGGAGG - Intergenic
1124694024 15:31848328-31848350 GCTGTGGGATTGAGATGAGGGGG + Intronic
1124923614 15:34049186-34049208 GAACTGGGCTGAAGCTGAGATGG + Intronic
1126702580 15:51381385-51381407 GTACTGGGAAGGGGGTGAGGTGG - Intronic
1127644072 15:60942782-60942804 ACCCTGGGATGGAGGTGGGGAGG + Intronic
1128381632 15:67117462-67117484 GCACTGGGCTGGAACTTGGGGGG - Intronic
1129163329 15:73760111-73760133 GCTCTGGGGTGGTGCAGAGGAGG - Intergenic
1129566837 15:76632611-76632633 GAACTGGGCTGAAGCTGAGACGG - Intronic
1129788484 15:78324495-78324517 GCACTGGGATGGAGAGGAGAGGG + Intergenic
1130085666 15:80777044-80777066 GCACAAGGATGTAGCTGAGGGGG + Intergenic
1130535831 15:84784349-84784371 GCACGGGGTTGGAGCTGTGAAGG - Exonic
1130597752 15:85258686-85258708 GCACTGGGGGGGAGCAGGGGAGG + Intergenic
1131110059 15:89759309-89759331 GCACTGGGCTGGAGCTTTGCAGG + Intergenic
1131117372 15:89803505-89803527 GCCCTGGGGTGGGGGTGAGGGGG + Exonic
1131832375 15:96361831-96361853 GGGCAGGGATGGAGCAGAGGTGG - Intergenic
1132381344 15:101368765-101368787 GCACTGGGCCGGAGCTGAGCAGG - Intronic
1133017269 16:2949879-2949901 GCACTGGCATGGAGATGTGACGG - Exonic
1134093846 16:11405910-11405932 CCACTGGGCTGGAGCTGGGTGGG - Intronic
1134643459 16:15847908-15847930 GGGCTGGGGTGGAGCTGCGGAGG + Intronic
1135042141 16:19125738-19125760 GCACTGGGGAGGAGGTGAGGAGG - Intronic
1136240066 16:28938076-28938098 GCACTGGGGCTGAGGTGAGGTGG - Intronic
1136519733 16:30787518-30787540 ACCCTGGGATGGGGCTGGGGTGG + Intergenic
1137954709 16:52817344-52817366 GCAATGGGAGGGAACTGTGGTGG + Intergenic
1138110646 16:54321135-54321157 GGCCTGGGAAGGAGCTGAGCAGG + Intergenic
1138269339 16:55683830-55683852 ACCCTGGGATGGGGTTGAGGGGG - Intronic
1138747549 16:59381086-59381108 GCCATGGGATGGGGCAGAGGTGG + Intergenic
1139551234 16:67674207-67674229 TCACTGGGGTGGAGGTTAGGAGG - Intergenic
1140021563 16:71243783-71243805 GGACTGGGATGGATATTAGGAGG + Intergenic
1140182576 16:72735565-72735587 GAACTGGGCTGAAGCTGAGATGG - Intergenic
1141291448 16:82721807-82721829 TCACTGTGATGGAGCAGAGAGGG + Intronic
1141787177 16:86209344-86209366 GCACTGGGAGGCAGCAGAAGAGG + Intergenic
1142396912 16:89837282-89837304 GGACTCGGATGGTGGTGAGGGGG + Intronic
1144353252 17:14419761-14419783 GCTCAGTAATGGAGCTGAGGAGG + Intergenic
1144817528 17:18046209-18046231 GCAGTGGAAAGGAGCTGGGGTGG + Intronic
1145229726 17:21164775-21164797 GCACTGGGCTAGGGCTGGGGTGG - Intronic
1145794778 17:27649305-27649327 GGACTGGGGTGGAGCTGCGTGGG - Exonic
1145929879 17:28677711-28677733 TGACTGGGATGGAGCGGAGCTGG - Exonic
1145980839 17:29010507-29010529 GCTCTGGGATGGATGGGAGGAGG + Intronic
1146660583 17:34662841-34662863 GCACTGGGCTGGAGCAAAGTTGG + Intergenic
1147395870 17:40142357-40142379 GCACTGGGATAGGGCTAAGTAGG + Intronic
1147726198 17:42567374-42567396 GCACTGGGGTGGAGTAGGGGCGG + Intronic
1147925339 17:43942349-43942371 GGCCTGGGATGGAGAGGAGGTGG - Intronic
1148284545 17:46375681-46375703 GTAATGGGATGCTGCTGAGGAGG - Intergenic
1148306766 17:46593602-46593624 GTAATGGGATGCTGCTGAGGAGG - Intronic
1148642430 17:49198297-49198319 GCACTTTGGGGGAGCTGAGGTGG + Intergenic
1148857000 17:50584346-50584368 GCACTGGGAAGGGGAAGAGGTGG + Intronic
1148924335 17:51069985-51070007 GCAGTGGCATGCACCTGAGGTGG + Intronic
1150595047 17:66596418-66596440 TCACTGGGATGGGGATGAAGTGG - Intronic
1151156637 17:72128474-72128496 GGGATGGGATGGAGCTGAAGTGG - Intergenic
1151442126 17:74136180-74136202 GGACAGGGTTGGAGCTGGGGGGG + Intergenic
1151799404 17:76368846-76368868 GCACAGGGATGGGGCGGTGGGGG + Intronic
1151874910 17:76862310-76862332 GCACTGGGATGGGGCCTATGTGG + Intergenic
1152067660 17:78120644-78120666 GAACTGGTGTGGAGGTGAGGGGG - Exonic
1152755999 17:82087296-82087318 GCACTGGGCTGGGGCTGGGGCGG + Intronic
1152807324 17:82362377-82362399 CCTCAGGGATGGAGCTGAGCTGG + Exonic
1152993346 18:383359-383381 GCAATGAGATGGAGGTGAGGAGG + Intronic
1153027286 18:683341-683363 GCGCTGGGATGTGCCTGAGGCGG - Exonic
1154315159 18:13298374-13298396 GCACAGTGATGGAGCTGCTGTGG + Intronic
1154498177 18:14977718-14977740 GGACCAGGATGGAGGTGAGGAGG + Intergenic
1156315690 18:35966871-35966893 GCACTGGGGTGGGTCTGAGCAGG + Intergenic
1157353610 18:46913775-46913797 GCACAGGGATGGAGGAGAGCAGG - Intronic
1159973772 18:74685453-74685475 AGACTGTGATGGTGCTGAGGAGG - Intronic
1161074535 19:2278946-2278968 GTACTTGGATGGAGCTGGGATGG + Exonic
1161220338 19:3115506-3115528 ACACAGGGAAGGAGCTGTGGGGG + Intronic
1161302765 19:3551027-3551049 GCTCCGGGATGAGGCTGAGGTGG + Exonic
1162780242 19:13002868-13002890 GCACTGAGCTTCAGCTGAGGGGG - Intronic
1162911072 19:13847937-13847959 GCACTGGGAGGGACGGGAGGCGG - Intergenic
1163250805 19:16125288-16125310 CCACAGGGATGGAGAGGAGGGGG + Intronic
1163533865 19:17866083-17866105 GCACAGGGAGGGGACTGAGGTGG - Intergenic
1164155815 19:22596320-22596342 TAACTGGGATAGAGCTGATGTGG + Intergenic
1164609743 19:29623985-29624007 GCAGGGGCATGGCGCTGAGGAGG + Intergenic
1165136691 19:33674145-33674167 GCACTGGGATGGAGGGATGGAGG + Intronic
1165359494 19:35327119-35327141 GAACTTGGATGGAGCGGAGCAGG + Intronic
1165391695 19:35542767-35542789 GCACTGAGGTGCAGCTGGGGAGG - Intronic
1165831129 19:38730988-38731010 GCACCTGGATGGGGGTGAGGGGG - Exonic
1166182210 19:41116947-41116969 GGACTGGGATTGGGTTGAGGTGG - Intronic
1166197914 19:41219043-41219065 GGCCAGGGAGGGAGCTGAGGAGG - Intergenic
1166867382 19:45848137-45848159 GCACTGGGCTGGGGCAGAGTTGG - Intronic
1167665886 19:50822632-50822654 GGACTGGGACGGGGCTCAGGAGG + Intronic
925106615 2:1297602-1297624 CCACTGGGAAGGAGCTGCAGAGG - Intronic
926719196 2:15946311-15946333 GCGCTGTCATGGAGGTGAGGTGG - Exonic
926931643 2:18046970-18046992 GCGATGGGGTGGAGCTGAGGAGG + Intronic
927491722 2:23525562-23525584 GCAGTGGGATGGAGCTAAGGGGG + Intronic
927558735 2:24053960-24053982 GGACTGGGTGGGGGCTGAGGGGG - Intronic
929588426 2:43130398-43130420 CCACTGGGATGCAGAGGAGGAGG + Intergenic
929596725 2:43180658-43180680 GCTTAGGGATGGAGCTGGGGTGG - Intergenic
929666968 2:43840776-43840798 GGAGTGGGATGGAGCTGAGGGGG - Intronic
929934711 2:46286336-46286358 CCACTGGGAAGGAGCTGACCAGG + Intergenic
930618955 2:53624739-53624761 GCCCTGGGATGGCGGTGGGGTGG - Intronic
930700952 2:54457111-54457133 GCGCAGGGATGGGGCGGAGGTGG - Intronic
931622981 2:64229736-64229758 GAATTGGGATGCAGCTGAGAGGG + Intergenic
932137241 2:69242186-69242208 GCAGAGGGATGGAGATGGGGTGG - Intronic
932239777 2:70147481-70147503 ACACTGGGCTGGAGCTGATGTGG - Intergenic
932397700 2:71459477-71459499 ATACTGGGAGTGAGCTGAGGGGG + Intronic
933667015 2:84971711-84971733 GCACTGTCATGGGGCGGAGGGGG + Intronic
933794276 2:85907166-85907188 CCAGTGGAATGGAGTTGAGGAGG + Intergenic
934859226 2:97749867-97749889 GCAGTGGCAAGGAGCTCAGGAGG + Intergenic
936493970 2:113001637-113001659 GCACAGGGTTGGGGCTGGGGAGG - Intergenic
936686114 2:114828785-114828807 GCACTGGGATGCAGCTATGCAGG + Intronic
936783237 2:116060163-116060185 GCACTGGGTTGGTTCTGTGGCGG + Intergenic
936832643 2:116667280-116667302 GCACTTTGGGGGAGCTGAGGTGG - Intergenic
937220498 2:120340511-120340533 CCACAGGGATAAAGCTGAGGGGG - Intergenic
937268727 2:120633577-120633599 GCTTTGGGAGAGAGCTGAGGTGG - Intergenic
937469677 2:122164487-122164509 GCACTGGGCAGAAGCTGAGCTGG + Intergenic
937872103 2:126793267-126793289 GCACAAGCCTGGAGCTGAGGAGG + Intergenic
937987044 2:127642616-127642638 GCAGTGGAAGGGACCTGAGGGGG - Intronic
938168901 2:129057639-129057661 GCCCTGGGATGGAAGTTAGGAGG - Intergenic
938558327 2:132446828-132446850 GGACAGGGATGAAGGTGAGGTGG + Intronic
938695055 2:133827499-133827521 GCCCTGGGTTGGACCTCAGGAGG + Intergenic
940866836 2:158825790-158825812 AGACTGGGATGGTGGTGAGGAGG - Intronic
941771288 2:169348812-169348834 GCACTGGGGTGGAGAAAAGGGGG + Intronic
942450370 2:176105183-176105205 GGCCTGGGATGGAGATGGGGAGG + Intronic
944219167 2:197285237-197285259 GCAGTGGGTTGGGGCTGGGGAGG - Intronic
944363795 2:198892437-198892459 GAACTGGGCTGAGGCTGAGGTGG + Intergenic
945285661 2:208078852-208078874 GCTCTGGGCTGGTACTGAGGAGG - Intergenic
945538961 2:211059293-211059315 TGCCTGGGATGGAGCTGATGAGG - Intergenic
947526276 2:230878450-230878472 GCAAGGGGATGGGGCTGTGGGGG + Exonic
947846609 2:233249766-233249788 CTACTGGGATGGGGCTGAGGTGG - Intronic
948111979 2:235463695-235463717 GCACTGGGGTGAAGCATAGGTGG + Intergenic
948354609 2:237368108-237368130 GCACGGGGTAGAAGCTGAGGTGG + Intronic
948591720 2:239054642-239054664 GCAGTGGGATGGAGAAGAGCTGG + Intronic
948701464 2:239763234-239763256 GCAGGGGGAGTGAGCTGAGGAGG - Intronic
948717576 2:239875135-239875157 TCACTGGGATGGACCAGAGATGG - Intergenic
948853755 2:240720707-240720729 ACACTAGGATGGAGCTGGCGGGG + Intronic
1170011592 20:11729135-11729157 GAACTGGGCTGAGGCTGAGGTGG + Intergenic
1170740463 20:19051522-19051544 ACACTGGGAAGGAGCTGAGAGGG - Intergenic
1172023754 20:31934313-31934335 ACTGTGGGATGGAGCTGGGGAGG - Intronic
1172820878 20:37733079-37733101 GCGCTGGGTGGGAGCTGAGATGG + Intronic
1173455926 20:43201177-43201199 GGACTGGGATGGAGGAGGGGGGG + Intergenic
1173946375 20:46954052-46954074 GCCCTGGGATGGAAATGAGCTGG - Intronic
1174386209 20:50190033-50190055 GCCCTGGGATGGGGCAGGGGCGG - Intergenic
1174390307 20:50214803-50214825 GCACTGAGATGGAGGAGAGATGG + Intergenic
1174953213 20:55066447-55066469 GAACTGGGATGAGGCTGAGATGG - Intergenic
1176096420 20:63346491-63346513 GCAGTGGCTTGGAGCAGAGGTGG - Exonic
1178361003 21:31948514-31948536 CCTCTGGGCTGTAGCTGAGGGGG + Intronic
1178926560 21:36780172-36780194 GATCTGAGGTGGAGCTGAGGCGG + Intronic
1178926692 21:36781168-36781190 GATCTGAGGTGGAGCTGAGGCGG + Intronic
1179094582 21:38301127-38301149 GCTCTCGGATGGTGCTGATGTGG - Exonic
1179479361 21:41667986-41668008 GCATTGGCATGGAAGTGAGGAGG + Intergenic
1179821967 21:43942330-43942352 GCTCTGGGAGGGAGCTGGCGAGG - Intronic
1179875222 21:44263484-44263506 GAACTGGGTCGGAGCAGAGGCGG + Intergenic
1179909124 21:44438705-44438727 GCACTGGGCGGGAGCTGGGAGGG + Intronic
1180049395 21:45324418-45324440 GGAGTGGGAGGGAGGTGAGGGGG + Intergenic
1180617485 22:17137996-17138018 GCAGTGCGGTGGAGGTGAGGGGG - Exonic
1180917510 22:19499380-19499402 GCACTGGGAGAGAACTGGGGAGG - Intronic
1181136270 22:20768750-20768772 GCTCTGGGTAGGTGCTGAGGAGG + Intronic
1181746992 22:24962388-24962410 GGATTGGCATGGAGCTGAGGGGG + Intronic
1182524827 22:30908401-30908423 TCACTGGAATAGAGGTGAGGCGG + Intergenic
1183055033 22:35299996-35300018 GCACCGGGGCGGAGCTGTGGGGG - Intronic
1183121459 22:35733111-35733133 GAAGTGGGATGGAGCTGGGATGG - Intergenic
1183583763 22:38740384-38740406 GCTCTGTGAAGGAGCTGAGGCGG - Exonic
1184287987 22:43482784-43482806 GCTCTGGGATGAGGCTGGGGTGG + Intronic
1184514159 22:44951230-44951252 GATCTGCGGTGGAGCTGAGGCGG - Intronic
1184560944 22:45262663-45262685 GCATAGGAATGAAGCTGAGGAGG - Intergenic
1185009326 22:48304548-48304570 GGACAGGGATGGAGGAGAGGAGG - Intergenic
1185233739 22:49699286-49699308 GCAGACGGATGGAGCTGAGCAGG + Intergenic
1203309562 22_KI270736v1_random:133161-133183 GCAGTGGAATGGAGTTGAGTTGG + Intergenic
949300671 3:2580319-2580341 GCAGTGGCAGAGAGCTGAGGAGG + Intronic
949347267 3:3088237-3088259 GCAGTGGGGTGGTGCAGAGGAGG + Intronic
949925530 3:9037994-9038016 GGAGTGGGATGGGGCTGGGGAGG - Intronic
950041950 3:9925489-9925511 GGACTGAGATGGAGAGGAGGGGG - Intronic
950185972 3:10945780-10945802 GGACTGGGATGGAGGGGTGGGGG - Intergenic
950408267 3:12817761-12817783 GCGCTGCGAGGGTGCTGAGGAGG + Exonic
950558436 3:13708617-13708639 GCACATGGAGGGAACTGAGGGGG + Intergenic
950558475 3:13708796-13708818 GCACTTGAAGGGAACTGAGGGGG + Intergenic
951879165 3:27463645-27463667 GCACTGGGATGAGGATGGGGTGG + Intronic
953833373 3:46322179-46322201 GATCTGGGGTGGGGCTGAGGAGG - Intergenic
954577508 3:51684677-51684699 CCCCTTGGGTGGAGCTGAGGAGG + Intronic
958438776 3:94130626-94130648 CCCCTGGGATGGGGATGAGGAGG - Intergenic
961333449 3:126156402-126156424 GCAGTGGCCAGGAGCTGAGGAGG + Intronic
961649049 3:128408403-128408425 GCCCTGGTGAGGAGCTGAGGGGG + Exonic
961696488 3:128708950-128708972 GCCCTGGAGAGGAGCTGAGGGGG - Intergenic
961782930 3:129331721-129331743 GCCCTGGGCTGGACCTGAAGAGG - Intergenic
962313697 3:134344618-134344640 GCACTGGGTTGGGGGTGAAGAGG + Intergenic
962386291 3:134935150-134935172 GCACTGGGATGGAGCTGAGGAGG + Intronic
963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG + Intronic
964519955 3:157554358-157554380 GCAATGGGCTGGAGCTGAGAAGG - Intronic
965165674 3:165192894-165192916 GCACTGGGAGGAAGCACAGGAGG + Intronic
965427975 3:168550794-168550816 GCAATGAGATGAAGCTGAGCAGG + Intergenic
966322581 3:178717323-178717345 GCCCTGGGCAGGATCTGAGGAGG - Intronic
966599213 3:181758845-181758867 GCAATGGGATGGGGGTCAGGGGG - Intergenic
966625146 3:182007724-182007746 GCACGATGATGGAGATGAGGTGG + Intergenic
966652227 3:182314645-182314667 GAACTGGGCTGAAGCTGAGAAGG - Intergenic
967096065 3:186178316-186178338 GCTGTGGGATGGAGCTTAGGTGG + Intronic
968066072 3:195760476-195760498 GCGCTAGGATGGAGTGGAGGGGG + Intronic
968066096 3:195760551-195760573 GCGCTAGGATGGAGTGGAGGGGG + Intronic
968331530 3:197874596-197874618 GGACAGGGCTGGAGCTGGGGGGG - Intronic
968598248 4:1496325-1496347 GCGGTGGGGTGGAGCTGGGGGGG - Intergenic
968726926 4:2252114-2252136 AGACTGGGATGGAGAGGAGGAGG - Intronic
968893066 4:3382352-3382374 GCTCAGGAGTGGAGCTGAGGAGG - Intronic
969135568 4:5026015-5026037 GCACTGGGAGGGAGTCGTGGAGG - Intergenic
969284775 4:6196326-6196348 GGACAGGGAAGGAGCTGTGGGGG - Intronic
969410567 4:7025372-7025394 TCCCTGGGCTGGAACTGAGGGGG + Intronic
970412236 4:15819381-15819403 GAACTGGGCTGAGGCTGAGGTGG + Intronic
970840656 4:20464506-20464528 TCAGTGGGATGGAGCTGCCGAGG - Intronic
971384698 4:26132411-26132433 GCTCTGGAAGGGAGCTCAGGTGG - Intergenic
973169997 4:47130271-47130293 GCAGTGGTATGGGGCTGTGGAGG - Intronic
975417237 4:74118946-74118968 GATCTGAGGTGGAGCTGAGGTGG + Intronic
975807442 4:78127496-78127518 GCACTGGGGTGGAGAAGAGGAGG + Intronic
976122745 4:81800920-81800942 GATCTGAGATGGAGCTGAGGTGG - Intronic
976179994 4:82389835-82389857 GATCTGAGGTGGAGCTGAGGTGG + Intergenic
976471443 4:85433824-85433846 ACAGTGGGATGGGGCTGAGAGGG + Intergenic
976757215 4:88511484-88511506 GAAATGGGATGGGGGTGAGGAGG + Intergenic
977414934 4:96721250-96721272 GAACTGGGCTGAGGCTGAGGTGG - Intergenic
977726820 4:100305724-100305746 GCAGTGGGATGTAGCTCCGGTGG + Intergenic
978800631 4:112752301-112752323 TCGCTGGGCTGGGGCTGAGGAGG + Intergenic
978857053 4:113405202-113405224 GCACTGGGCTTCAGCTTAGGTGG - Intergenic
979908028 4:126322004-126322026 GGACGGAGATGGAGCTGAGTAGG - Intergenic
982750201 4:159151933-159151955 GCAGTGGGAAGGAGCTGTTGAGG + Intronic
982856040 4:160384211-160384233 GTACTGGGAATGAGCTGAGAAGG - Intergenic
984854107 4:184178001-184178023 GAACTGGGCTGAAGCTGAGATGG + Intronic
984980886 4:185280031-185280053 GGACTGGGCTGAGGCTGAGGTGG - Intronic
985133357 4:186760819-186760841 ATACTGGGATGGAGCGGAGGAGG + Intergenic
985552782 5:541766-541788 ACACTGGGGTGGGGCTGGGGAGG + Intergenic
985623833 5:973304-973326 ACACTGGGATCTACCTGAGGGGG + Intergenic
986013712 5:3739696-3739718 GCACCGGCATGGAGCTGGGCTGG - Intergenic
986028226 5:3871049-3871071 GCCCTGGGGTGGACCTGTGGAGG - Intergenic
987993327 5:25243967-25243989 GATCTGAGGTGGAGCTGAGGTGG - Intergenic
989188427 5:38646623-38646645 GCACTGGGATGAACCTATGGGGG - Intergenic
989257016 5:39376910-39376932 GCTCTGGGAGGTGGCTGAGGAGG + Exonic
991383179 5:66054334-66054356 GATCTAGGAAGGAGCTGAGGAGG - Exonic
992378204 5:76210540-76210562 GCACTGGGATGGTGGTGAGGCGG - Intronic
992662931 5:78979519-78979541 GCACTGGGGTGGAGCCACGGAGG + Intronic
992804443 5:80323260-80323282 CTACTGGGATGGTGCAGAGGAGG + Intergenic
992872556 5:81021756-81021778 GCACTGGGATATAGCAGAGAAGG + Intronic
992903432 5:81321697-81321719 GCACTTTGGTGGGGCTGAGGTGG + Intergenic
993044222 5:82849037-82849059 GCATAGGGATTGAGCGGAGGGGG + Intergenic
993250090 5:85510777-85510799 GCTCTGGGATGCAGCAAAGGTGG - Intergenic
994298924 5:98122514-98122536 GAACTGGGCTGAGGCTGAGGTGG + Intergenic
995464132 5:112433482-112433504 GATCTGAGGTGGAGCTGAGGTGG - Intergenic
995544670 5:113218090-113218112 GCACGGGGGTGGGGGTGAGGTGG + Intronic
995861599 5:116646896-116646918 GATCTGAGATGGAGCTGAGGTGG - Intergenic
997664659 5:135620315-135620337 TCATGGGGATGGAGCTGAGCTGG + Intergenic
997900590 5:137760343-137760365 GATCTGAGGTGGAGCTGAGGTGG - Intergenic
998394448 5:141809631-141809653 GCCCTGGGATGGGGATGAGCCGG + Intergenic
999106472 5:149075448-149075470 GCACTGGTATGGCTCTGGGGAGG - Intergenic
999112821 5:149136967-149136989 GCAGAAGGAAGGAGCTGAGGTGG - Intergenic
999844966 5:155469662-155469684 GCACAGGGAGGGAGCGCAGGAGG - Intergenic
1001301511 5:170537064-170537086 GCACAAGGACGGACCTGAGGGGG - Intronic
1001968725 5:175936638-175936660 CTACTGGGAGGGGGCTGAGGTGG - Intronic
1002060252 5:176621459-176621481 GAAGTGGGATGGAGGTGAAGGGG + Intronic
1002248718 5:177907099-177907121 CTACTGGGAGGGGGCTGAGGTGG + Intergenic
1004263564 6:14129667-14129689 GGGCTGGGAGGGAGCTGAGCAGG + Intronic
1004681834 6:17903635-17903657 GCACAGGGATGGGGATGTGGTGG + Intronic
1005752149 6:28893601-28893623 GCACTTGGGTGAGGCTGAGGAGG - Intergenic
1006011445 6:31045922-31045944 CCACAGGCATGGAGCTGATGAGG + Intergenic
1006602007 6:35232529-35232551 GCACTGTGCTGGAGATGGGGTGG - Intronic
1007248951 6:40482733-40482755 GGCCTGGGGTGGAGCTGAGATGG - Intronic
1007734434 6:43971900-43971922 TGGCTGGGGTGGAGCTGAGGAGG + Intergenic
1007923199 6:45629243-45629265 CCAGTGGGATGGAGGTGAGCAGG + Intronic
1008514824 6:52308955-52308977 GCACGGAGTTAGAGCTGAGGAGG - Intergenic
1008654945 6:53602291-53602313 TCAGTGAGATGGAGCTGAGAAGG + Intronic
1008845228 6:55955112-55955134 ACACTGTGATGAAGCTGGGGTGG + Intergenic
1009565805 6:65310019-65310041 GCAATGGGAGGGACCTGAAGGGG - Intronic
1009813042 6:68694462-68694484 GCACTGGTATGGGAGTGAGGTGG + Intronic
1010158149 6:72819773-72819795 GCACTGGGACAAAGCTGAGATGG - Intronic
1010490968 6:76476376-76476398 GCACTGGGCTGCAGCTGATCAGG - Intergenic
1012507712 6:99968163-99968185 ACCCTGGGATGGAGAGGAGGTGG + Intronic
1012614377 6:101258560-101258582 GATCTGAGGTGGAGCTGAGGTGG + Intergenic
1014845290 6:126268371-126268393 GCACTGGAGTTGAGCTGGGGAGG + Intergenic
1015368458 6:132424551-132424573 GAACTGGGCTGAGGCTGAGGTGG - Intergenic
1016801328 6:148172152-148172174 ACAGTGGGATGGTGCTGAGTGGG - Intergenic
1017255109 6:152324545-152324567 GCACTTGGCGGGGGCTGAGGCGG + Intronic
1017442346 6:154475598-154475620 GGACTTGGATGGAGCTGAGAGGG - Intronic
1017811633 6:157988105-157988127 GCCCTGGGAGGGGGCTGAGCAGG - Intronic
1018299538 6:162386589-162386611 GCACTGGGCTGGCCCTCAGGAGG + Intronic
1018596281 6:165484537-165484559 GATCTGAGATGGAGCTGAGGTGG + Intronic
1018651410 6:165994494-165994516 GGACTGCTATGGAGATGAGGTGG + Intergenic
1019452039 7:1104015-1104037 GCACGGGGCTGGTGCTTAGGTGG - Intronic
1019538355 7:1540356-1540378 GCACTAGGATGCAGCCGAGAAGG - Exonic
1019804974 7:3117024-3117046 CCACAGGGATGGAGTTGGGGAGG + Intergenic
1019810503 7:3161925-3161947 GCACTTTGGTGAAGCTGAGGCGG + Intronic
1019857040 7:3619801-3619823 GCACTGGGGTGGACATGATGTGG + Intronic
1020555890 7:9669877-9669899 GCATGGGGGTGGAGCTGAGGTGG - Intergenic
1020599057 7:10248965-10248987 GAACTGGGCTGAAGCTGAGTTGG + Intergenic
1022376136 7:29813165-29813187 GCAATGGGATAGAGCCAAGGAGG - Intronic
1022883923 7:34622199-34622221 GCACTGGCATGGGGCTGCAGGGG - Intergenic
1023641934 7:42268114-42268136 GCACTGGGATGGTGGAGAGGAGG - Intergenic
1023986344 7:45099361-45099383 ACAGTGGGGTGGAGCTGAGATGG - Intergenic
1024300472 7:47883692-47883714 GCAGTTGGAAGCAGCTGAGGAGG + Intronic
1026411477 7:70127379-70127401 GCTTTGGGAGGGGGCTGAGGAGG - Intronic
1026635156 7:72075669-72075691 GTGCAGGGATGGAGCTGAGCAGG - Intronic
1026645712 7:72166435-72166457 GCACTTTGAGGGGGCTGAGGTGG - Intronic
1027135884 7:75623684-75623706 GAACTGGGCTGGAGAAGAGGAGG - Intronic
1029206755 7:98873907-98873929 GCTATGGGATGGAGCAGAGATGG - Intergenic
1029458430 7:100682548-100682570 GCTCCGGGATGGCCCTGAGGGGG - Intronic
1030199158 7:106884883-106884905 GATCTGAGGTGGAGCTGAGGTGG - Intronic
1030624475 7:111829467-111829489 GCTGTGGGATGGGGTTGAGGAGG + Intronic
1031392977 7:121238500-121238522 GCACTGGGAAGAAGCTAAGCTGG - Intronic
1032552577 7:132798641-132798663 GCAGGGGGAAGGAGGTGAGGAGG + Intronic
1032783933 7:135186047-135186069 GCACTGGCAGGGAGCTGGAGTGG + Exonic
1032970073 7:137150927-137150949 GCAAAGGGCTGGAGATGAGGGGG + Intergenic
1033533001 7:142285039-142285061 CCAATGGGATGGTGTTGAGGTGG + Intergenic
1033741355 7:144278026-144278048 GCACTGCATTGGAGATGAGGTGG - Intergenic
1033752548 7:144371588-144371610 GCACTGCATTGGAGATGAGGTGG + Intronic
1033813559 7:145046123-145046145 GCACTGCCCTGGAGCTCAGGTGG + Intergenic
1034336839 7:150329428-150329450 GCACTGGCCTGGAGCTGGGTGGG + Intronic
1034473333 7:151268307-151268329 ACAATCGGGTGGAGCTGAGGAGG + Intronic
1035279660 7:157769762-157769784 GGTCTGGGAGGGAGCTGTGGTGG - Intronic
1035313769 7:157985629-157985651 CCACAGTGATGGATCTGAGGGGG - Intronic
1035332648 7:158106375-158106397 GAGCTGGGAGGGAGCAGAGGTGG - Intronic
1035810290 8:2485680-2485702 GCACAGGGAGGGGACTGAGGTGG - Intergenic
1036032855 8:4992235-4992257 GCGCTAGGATGAGGCTGAGGCGG - Intronic
1036180946 8:6585006-6585028 GCACTGGGATGGGGATCAGAGGG - Intronic
1036653810 8:10662739-10662761 GGACTGGGATGGAGGAAAGGCGG - Intronic
1036667005 8:10752841-10752863 GCTCTGAGAAGAAGCTGAGGTGG - Intronic
1037858438 8:22388218-22388240 GGATTGGGGTGGATCTGAGGTGG + Intronic
1037993378 8:23336360-23336382 ACACTGGGATGGAGGAGGGGAGG - Intronic
1038503001 8:28060981-28061003 GCACTGGGCTTGAGGTGAGGTGG - Intronic
1040109918 8:43562696-43562718 GCCCTGTGCTGGACCTGAGGGGG - Intergenic
1040913408 8:52543963-52543985 GCTATGGGGTGGAGATGAGGAGG - Intronic
1041524124 8:58786937-58786959 GTCCTGTGATGGAGCTGAGTGGG + Intergenic
1041526676 8:58814212-58814234 GGACTGGGATCGAGATGAAGCGG - Intronic
1041539561 8:58967577-58967599 GCACCTGGCTGGAGCTGAGGAGG + Intronic
1043377637 8:79668254-79668276 GGGCTGGGATAGAGCTAAGGTGG + Intergenic
1044117119 8:88349545-88349567 GAACTGGGCTGAAGCTGAGATGG - Intergenic
1044593052 8:93932338-93932360 GCACTGGTGGGGAGCTGTGGTGG + Intergenic
1046225583 8:111274701-111274723 CCTCTGGGATACAGCTGAGGTGG + Intergenic
1048578115 8:135708918-135708940 GAAGTTGGGTGGAGCTGAGGAGG + Intergenic
1049165362 8:141122252-141122274 GCACTGGGATGGGGCGGCGGTGG - Intronic
1049195533 8:141313737-141313759 GCCCTGGGATGCAGGTGAGTAGG + Intergenic
1049238608 8:141525288-141525310 GCACTGAGATGGGGCTGCTGGGG + Intergenic
1049240187 8:141533811-141533833 GCCTTGGGATGGAGCTGTGCAGG + Intergenic
1050057052 9:1666601-1666623 GATCTGAGGTGGAGCTGAGGTGG + Intergenic
1050061222 9:1711778-1711800 GTACAGGGATTGAGCTGAGCTGG + Intergenic
1052963476 9:34320049-34320071 AGACTGGGATAGAGCTGGGGAGG - Intronic
1053204268 9:36173116-36173138 GCCCTGGGAGAGTGCTGAGGAGG + Intergenic
1053206246 9:36188853-36188875 GCAGAGGTATGGAGCTGAGTGGG - Intergenic
1055842142 9:80518385-80518407 GAACTGGGCTGAAGCTGAGAAGG - Intergenic
1056449909 9:86706837-86706859 GCAAGGTGATGGGGCTGAGGGGG - Intergenic
1057612273 9:96555645-96555667 GCACAGAGATGCAGCTTAGGAGG + Intronic
1059282860 9:113149657-113149679 GCACTGTGATGGGGCTGGAGAGG - Intergenic
1060746057 9:126131647-126131669 GCACAGGGAGGCAGATGAGGTGG + Intergenic
1062003242 9:134227181-134227203 GCAGGGGGATGGTGCTGGGGGGG + Intergenic
1062189512 9:135240617-135240639 ACATTGGGATGGAGCAGAGATGG - Intergenic
1203390855 Un_KI270438v1:95992-96014 GCAATGGGATGGAACTGAATGGG + Intergenic
1187507451 X:19888354-19888376 GCACTGGGGCGGGGCTTAGGCGG - Intergenic
1188065909 X:25659057-25659079 GATCTGAGGTGGAGCTGAGGCGG - Intergenic
1188797615 X:34484588-34484610 GATCTGGCCTGGAGCTGAGGTGG + Intergenic
1188835364 X:34948203-34948225 GCACTGGCATAGAGATGTGGAGG - Intergenic
1189751345 X:44225956-44225978 GCACTTGGCAGGAGCTGATGTGG + Intronic
1189855091 X:45215530-45215552 GAACTGGGCTGAAGCTGAGATGG + Intergenic
1190745493 X:53319937-53319959 GGTAAGGGATGGAGCTGAGGCGG + Intronic
1192142617 X:68658788-68658810 CCAGAGGGATGGAGTTGAGGAGG - Intronic
1192478656 X:71466078-71466100 GCATTGGGATGGGGAGGAGGGGG + Intronic
1192849181 X:74935996-74936018 GTTATGGGATGGAGCTCAGGTGG + Intergenic
1193909051 X:87280051-87280073 GAACTGGGCTGAAGCTGAGATGG - Intergenic
1194281253 X:91957265-91957287 GAACTGGGCTGAAGCTGAGACGG - Intronic
1194647106 X:96471373-96471395 GCACTGGGATTCAGCTAAGCAGG + Intergenic
1195085381 X:101408440-101408462 GCACTGAGATGGGGGGGAGGAGG - Intronic
1195929806 X:110063369-110063391 ACACTGGGGTGGAGCAGAAGTGG + Intronic
1196233738 X:113255349-113255371 GCCCTGGGCTGGAATTGAGGAGG - Intergenic
1198332281 X:135632921-135632943 GCACAGGGATGGATGGGAGGGGG + Intergenic
1198388216 X:136147928-136147950 GCAGTGGGGTGGAGGTGGGGGGG + Intronic
1198410237 X:136359928-136359950 GCACTGGGAAGGAGGTGGAGTGG - Intronic
1199845814 X:151692568-151692590 GCACAGGGATGGGGCTGGGGAGG + Intergenic
1200287471 X:154837535-154837557 ACACTGCCCTGGAGCTGAGGAGG + Exonic
1200424901 Y:3009700-3009722 CCACAGGAGTGGAGCTGAGGGGG - Intergenic
1200598843 Y:5181929-5181951 GAACTGGGCTGAAGCTGAGACGG - Intronic
1202360663 Y:24106545-24106567 GCACTTTGAGGGGGCTGAGGTGG - Intergenic
1202510115 Y:25563573-25563595 GCACTTTGAGGGGGCTGAGGTGG + Intergenic