ID: 962386312

View in Genome Browser
Species Human (GRCh38)
Location 3:134935301-134935323
Sequence CAGGCGAAGAAGGGAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962386312 Original CRISPR CAGGCGAAGAAGGGAGGGTC AGG Intronic
900670941 1:3854369-3854391 CAGGACAAGAAGTGAGGGTCAGG - Intronic
901033136 1:6320028-6320050 TAGGGGAGGAAGGGAGGTTCTGG + Intronic
902632054 1:17710811-17710833 CTGGAAAAGAAGGGAGGTTCAGG - Intergenic
903462781 1:23530934-23530956 CGGGCCAGGAGGGGAGGGTCCGG - Exonic
903774430 1:25783593-25783615 CTGGGGAAGAAGGGTGGGCCTGG - Intronic
904131800 1:28281044-28281066 CAGGGGAAGGAGGAAGGGTGTGG - Exonic
905881726 1:41468373-41468395 AAGGAAAAGAAGGGAGGGTGAGG - Intergenic
906304337 1:44707024-44707046 CAGGGGTTGAAGGCAGGGTCAGG - Intronic
907466659 1:54642183-54642205 CAGGGGAGGAAGGGATGGTGGGG + Intronic
909286523 1:73826916-73826938 GAGGGGAAGAAGGGAGGGTAGGG + Intergenic
909674200 1:78220937-78220959 AAGGGGAAGAATGGAGGATCAGG - Intergenic
910725691 1:90336320-90336342 CAGAAGAAGTAGGCAGGGTCAGG + Intergenic
911549805 1:99264794-99264816 TAGGGGAAGAGGGGAGGGTCGGG - Intronic
913119343 1:115725535-115725557 CAGGCGACGTAGAGTGGGTCTGG + Exonic
913526981 1:119702976-119702998 GAGGGGAAAAAGGGAGGGTATGG - Intronic
914921609 1:151851215-151851237 CAGCCGGAGAAGGGAGGGTATGG + Intronic
915043978 1:152995654-152995676 CAGGGGGAGAAGGGAGAGTGTGG + Intergenic
915193447 1:154171402-154171424 CAGGCGGAGAAGGTAGGGGCTGG - Exonic
915214226 1:154329212-154329234 CAAACGAAGAAGGTAGGGACTGG - Intronic
915899585 1:159836755-159836777 CAGGCCAGGCAGGGAGGATCTGG - Exonic
918072914 1:181146631-181146653 CAGGCCAGGAAGGGAGGGGAAGG + Intergenic
919143227 1:193600448-193600470 CTGAGGAGGAAGGGAGGGTCTGG - Intergenic
920052091 1:203170491-203170513 CAGGGTAAGCAGGGAGGGTGAGG - Intronic
920494809 1:206447186-206447208 TAGGGGAAGAAGGGAGGGGGAGG - Intronic
924216358 1:241826406-241826428 CAAGCGAGGGAGGGAGGTTCTGG + Intergenic
924282060 1:242448333-242448355 CTGGTGATGAAGGGAGGGTTGGG - Intronic
924614740 1:245603310-245603332 AAGGGGAAGAAGAGAGGCTCAGG + Intronic
1063188301 10:3669978-3670000 CATGCGAAGAAGGGGGGTTGGGG - Intergenic
1064102289 10:12474115-12474137 CAGAGGAAGAGGGGAGGGGCAGG + Intronic
1065836225 10:29660706-29660728 CAGGGGAAGACGTGAGCGTCTGG - Intronic
1066100169 10:32110453-32110475 CAGGAGAAGGTGGGAGGGACGGG + Intergenic
1067221179 10:44345473-44345495 CAGGAGCAGAAGGCAGGGACAGG + Intergenic
1067267951 10:44763431-44763453 CAGGTGAAGAAGGGAGAGGTTGG + Intergenic
1067295976 10:44975399-44975421 GAGGCGAAGAAGGGAGTGAGTGG - Intronic
1067945470 10:50685774-50685796 GAGGGCAAGAAGGAAGGGTCTGG + Intergenic
1068962572 10:62880466-62880488 GAGACCAAGATGGGAGGGTCTGG - Intronic
1069788841 10:71006545-71006567 CAGGCTCAGAAGGCAGGGTGGGG - Intergenic
1069897815 10:71689736-71689758 CAGGGGAAGAAGTGATGCTCAGG + Intronic
1070866983 10:79712647-79712669 GAGGGCAGGAAGGGAGGGTCTGG + Exonic
1070880773 10:79850768-79850790 GAGGGCAGGAAGGGAGGGTCTGG + Exonic
1070949282 10:80418167-80418189 CAGCTGAAGAGGGGAGGGTGGGG - Intronic
1071096600 10:81982600-81982622 CAAGCCAAGAAGAGAGGCTCAGG - Intronic
1071633895 10:87234870-87234892 GAGGGCAGGAAGGGAGGGTCTGG + Exonic
1071647345 10:87367087-87367109 GAGGGCAGGAAGGGAGGGTCTGG + Exonic
1075396315 10:122130294-122130316 CAGATGAAGAAGGGGGAGTCTGG - Intronic
1076050439 10:127329256-127329278 CAGGGGAAGCAGGGGAGGTCAGG - Intronic
1076980954 11:204478-204500 CAGGCAAAGCAGGCAGGGCCAGG - Exonic
1077088219 11:765329-765351 CAAGAGCAGGAGGGAGGGTCCGG - Intergenic
1077172784 11:1175430-1175452 AGGGGGAAGAAGGGAGGGTGTGG + Intronic
1077370556 11:2179806-2179828 CAGGTGCAGAAGGGAAGGACAGG - Intergenic
1077607595 11:3622615-3622637 CAGGGGAAGGAGGGAGAGTAGGG - Intergenic
1079402158 11:20114562-20114584 CAGGCAAAGAAGGAACAGTCTGG - Intronic
1083588811 11:63880187-63880209 CAGGAGAAGATGGGAGATTCTGG + Intronic
1083597133 11:63923331-63923353 CATGGGATGAAGGGAGGGTTGGG - Intergenic
1084022139 11:66424093-66424115 CAGGCCCAGAAGGGAATGTCAGG - Exonic
1084532736 11:69738388-69738410 CAGGAGAAGATGCGAGGCTCTGG + Intergenic
1085758265 11:79219568-79219590 CAGGTGAAGAAAGGAGACTCTGG + Intronic
1087078767 11:94150370-94150392 CAGGTGGAGAAGGGAGAGACTGG + Intronic
1088808905 11:113376403-113376425 CACCCGAAGAGGGGAGGGTGAGG - Intronic
1089174972 11:116541811-116541833 CAGGCAAAGAGGGGAAGGTAGGG + Intergenic
1089407077 11:118206688-118206710 CAGGGGAAGTCGGGAGGGTGGGG - Intronic
1089709650 11:120305879-120305901 CAGGAGAAGAAGGGGGTGTTAGG - Intronic
1089986541 11:122819383-122819405 CAGGAGAAGAAAGGAGGTGCTGG - Intergenic
1090076400 11:123582451-123582473 GAGGCTAAGATGGGAGGGTGTGG + Intronic
1090490139 11:127153488-127153510 CAGGAGAAAAAGGTAGGGTTGGG - Intergenic
1091124342 11:133082372-133082394 GAGGGGAAGAGGGGAGGGTGGGG - Intronic
1091283750 11:134396837-134396859 CAGGTGGAGAGGAGAGGGTCTGG + Intronic
1091405144 12:204268-204290 CAGGGGCAGAAGCGAGGGGCTGG - Intronic
1091446184 12:545487-545509 CAGGAGCAGATGGGAGGGACCGG - Intronic
1091549777 12:1529123-1529145 AAGGGGCAGCAGGGAGGGTCAGG - Intergenic
1094147280 12:27244046-27244068 CAGGCGGAGATGGGTGGGGCCGG + Intronic
1094488339 12:30942330-30942352 CAGAGGAGGAAGGGAGGCTCTGG + Intronic
1095099285 12:38163697-38163719 CCGGCGACGGAGGGAGGCTCTGG - Intergenic
1095709085 12:45269095-45269117 CCAGAGAAGAAGGGAGGGCCTGG - Intronic
1095947865 12:47764006-47764028 CAGGCGAAGACGGGCAGGGCTGG + Intronic
1096529243 12:52233061-52233083 CAGTCCAAGCAGGGATGGTCCGG - Intronic
1096616324 12:52835249-52835271 CAGGGGAAGATGGGAGTGACGGG - Intergenic
1096652300 12:53067852-53067874 CAGGGGAACCAGGGAGGGTGAGG + Intronic
1097257946 12:57694727-57694749 CTGGGAAAGAAGGGAGGGTCGGG - Intronic
1097262746 12:57728684-57728706 TGGGAGAAGAAGGGAGGGTCAGG + Intronic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1100966523 12:100019190-100019212 GAGGGGAAGGAGGGAGGGTATGG + Intergenic
1101285369 12:103306503-103306525 AAGAAGAAGAGGGGAGGGTCTGG + Intronic
1101598431 12:106188312-106188334 GAGGCTGAGAAGGGAGGGTGTGG - Intergenic
1101874851 12:108591422-108591444 GAGGCCAAGGAGGGAGTGTCAGG + Exonic
1102171115 12:110843103-110843125 CAGGGGAAGATGGAAGGGGCTGG + Intergenic
1103918417 12:124387652-124387674 CAGGCGCAGAAGGGGAGGGCCGG + Intronic
1103976500 12:124706031-124706053 AATGCGAAGCAGGGAGAGTCGGG + Intergenic
1104900847 12:132188863-132188885 CAGGAGCAGGAGGGAGGGTGGGG + Intergenic
1111480557 13:88819911-88819933 CAGACAAAGAAGGGAGGGGTGGG + Intergenic
1114552743 14:23542969-23542991 CAGGCCAAGGTGGGCGGGTCAGG - Intronic
1115771418 14:36666599-36666621 CAGGTGAGGAGGCGAGGGTCAGG + Exonic
1119133725 14:72197499-72197521 CAAACGAAGAAGGGAAGGCCTGG + Intronic
1121298146 14:92846970-92846992 AAAGCCAAGAAGGGAAGGTCTGG - Intergenic
1121552217 14:94811524-94811546 TAGGAGAAGAGGAGAGGGTCAGG - Intergenic
1121682569 14:95805968-95805990 CAGGAGAGGAAGGGAGGGGCTGG - Intergenic
1121908688 14:97769740-97769762 CAGGAGAAGAAGGGCGTCTCAGG + Intergenic
1122100725 14:99407668-99407690 CAGGAGTAGAAGGTAGTGTCAGG - Intronic
1122250366 14:100434953-100434975 CAGGAGCAGAAGGAAGGATCAGG - Intronic
1122637454 14:103137006-103137028 CAGGGGATGAACGGAGGGTGCGG - Exonic
1123678880 15:22741742-22741764 GAGGCCAAGGAGGGAGGATCAGG - Intergenic
1124331089 15:28816035-28816057 GAGGCCAAGGAGGGAGGATCAGG - Intergenic
1124358484 15:29016790-29016812 CAGGCAAAGAAGGAAGGGAGGGG - Intronic
1124694657 15:31853891-31853913 CAGGCACAGAAGAGAGGGTAGGG + Intronic
1125605416 15:40937379-40937401 CAGGCGTGTAAGGGAGGGACGGG - Intronic
1126443690 15:48718947-48718969 GAGAAGATGAAGGGAGGGTCTGG + Intronic
1127055799 15:55129907-55129929 CAGGTGAGGAAGTCAGGGTCTGG - Intergenic
1127604739 15:60574980-60575002 CAGGAGAAGAAGAGGAGGTCTGG + Intronic
1128072856 15:64808106-64808128 CAGGCCAAGATGGGAGGGGTGGG - Intergenic
1128680558 15:69648367-69648389 CAGGCGGAGAAGGGGGCGGCCGG - Intergenic
1128741478 15:70086861-70086883 AAGGGGAAGAAGGCAGGGTGGGG - Intronic
1129471595 15:75758588-75758610 CAGGCCAAGAAGCCAGGGCCCGG - Intergenic
1129673116 15:77617919-77617941 GAGGGGCTGAAGGGAGGGTCAGG - Intronic
1129706999 15:77800024-77800046 CAAGGAAAGAAGGGAGGGCCAGG + Intronic
1130306088 15:82712957-82712979 CAGGAGAAAAAGGAAGGATCAGG - Intergenic
1130773021 15:86944074-86944096 CAGGTGAAGAATGAAGGGTGGGG + Intronic
1131504582 15:93005319-93005341 CAGGAGAAGAGGGGAGGGCAAGG + Intronic
1131676638 15:94676782-94676804 CAGGAGAAGGAGGTGGGGTCAGG - Intergenic
1132180684 15:99750614-99750636 GAGGGGAAGGAGGGAGGGTGCGG - Intergenic
1132180695 15:99750661-99750683 GAGGGGAAGGAGGGAGGGTGCGG - Intergenic
1132180706 15:99750708-99750730 GAGGGGAAGGAGGGAGGGTGCGG - Intergenic
1132180717 15:99750755-99750777 GAGGGGAAGGAGGGAGGGTTCGG - Intergenic
1132612041 16:822045-822067 CAAGTGAAGAAAGAAGGGTCAGG - Intergenic
1133046759 16:3092427-3092449 GAGGTGAAGAAGGAATGGTCAGG + Intronic
1133909456 16:10051795-10051817 CTGGCAGAGAAGGCAGGGTCTGG - Intronic
1134233709 16:12449315-12449337 CAGGCAAAGAAGGCACGGTGGGG + Intronic
1134265066 16:12685665-12685687 CAGGAGGAAAAGGGAGGGTGTGG - Intronic
1136449601 16:30346237-30346259 CAGGGGAAGAAGAGGGTGTCTGG - Intergenic
1136470217 16:30474564-30474586 CAGGGGAGTAAGGGAGTGTCAGG - Intronic
1136533014 16:30882517-30882539 CAGGCGAAGAGGGGAAGGGAGGG + Intronic
1137405594 16:48186876-48186898 CAGGGAAAGAATGGAGCGTCTGG - Intronic
1138421680 16:56903190-56903212 GAGGCTAAGCAGGGAAGGTCAGG - Intronic
1139372373 16:66477128-66477150 CAGGGGAAGAGGGGAAGGCCGGG - Intronic
1141012313 16:80414299-80414321 CAGGTGAAGGAGGGAAGGACAGG - Intergenic
1141377088 16:83541387-83541409 CAGGCAAAGAAGAGAGGAGCTGG - Intronic
1141382580 16:83589293-83589315 GAGGGGAAGAAGGGAGGGAGAGG - Intronic
1141508275 16:84495425-84495447 CAGGGGAAGGAGGGAGGGTCTGG - Intronic
1141694791 16:85614182-85614204 CAGGCGGAGCAGGAAGGGCCGGG - Intronic
1141961896 16:87414394-87414416 CAGGTGAACAAGGGTGTGTCGGG - Exonic
1143263050 17:5614525-5614547 GAGGAGGAGAAGGGAAGGTCCGG + Intronic
1143296392 17:5874916-5874938 CAGGAGAGGAAGGGAAGGTGGGG - Intronic
1146062747 17:29615636-29615658 CAGCCCAAGAAGGCGGGGTCCGG + Exonic
1146501916 17:33372069-33372091 CAGGAGAGGCAGAGAGGGTCTGG - Intronic
1146902453 17:36597584-36597606 AAGGCATAGAAAGGAGGGTCAGG + Intronic
1147446095 17:40476144-40476166 CCGGGGTGGAAGGGAGGGTCAGG - Exonic
1147654347 17:42080373-42080395 CAGGAAATGAAGGGAGGGTCAGG - Intergenic
1149478274 17:56981879-56981901 ATGGAGAGGAAGGGAGGGTCAGG - Intronic
1150168119 17:62964566-62964588 CAGATGAAGAAAGGAAGGTCCGG + Intergenic
1150427863 17:65091159-65091181 CAGGCGAGGAAGGGAGGAGTGGG - Intergenic
1151937854 17:77274276-77274298 CCTGCCAAGAATGGAGGGTCTGG - Intergenic
1152648129 17:81479684-81479706 CAGGCGGAGAAGCCAGGGACAGG + Intergenic
1155388479 18:25307545-25307567 CAGGAAAGGAAGGCAGGGTCTGG - Intronic
1157346731 18:46843408-46843430 CAAGAGGAGATGGGAGGGTCAGG - Intronic
1157451847 18:47795048-47795070 CAGGTGAAGAAGCTAGGGGCTGG + Intergenic
1159051083 18:63422105-63422127 GAGGCGCAGGAGGGCGGGTCCGG - Intronic
1160560182 18:79751108-79751130 CAGGCCAGGGAGGGAGGGGCTGG + Intronic
1160560217 18:79751206-79751228 CAGGCTAGGGAGGGAGGGGCTGG + Intronic
1160560254 18:79751309-79751331 CAGGCCAGGGAGGGAGGGGCTGG + Intronic
1160573178 18:79832258-79832280 CAGGTGAAGAAGGGCAGGTGAGG - Intergenic
1161657293 19:5524101-5524123 AAGACAGAGAAGGGAGGGTCTGG - Intergenic
1162394551 19:10409260-10409282 CAGGCGAGGGAGGCAGGGCCCGG - Intronic
1162583353 19:11544169-11544191 GAAGGGAAGATGGGAGGGTCAGG + Intronic
1163082364 19:14953255-14953277 GAGGCGAGGAGGGGAGGGGCGGG - Intronic
1163183360 19:15619335-15619357 CAGAAGAAGAAAGGAGGGTGGGG - Intronic
1163217647 19:15892716-15892738 CAGAGGAAGAAGGGAGGATGGGG + Intronic
1163325920 19:16603194-16603216 CAGCCAAAGAAGAGAGGGGCTGG + Intronic
1163677090 19:18660616-18660638 CAGGCGGAGGAGGGAGGGCCGGG - Intronic
1164161021 19:22625427-22625449 CAGGCGAAAAAGTAAGGGACTGG - Intergenic
1164463044 19:28464638-28464660 CAGAGGAGGGAGGGAGGGTCGGG - Intergenic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
1166960649 19:46494168-46494190 CAGGCGAAGAAGGCTGGGCGTGG - Exonic
1167745880 19:51351624-51351646 CAGGCCAAAAAGGCAGGGCCTGG - Intronic
1167866541 19:52333362-52333384 CTGGCAAAGGAGGGAGGGACCGG + Intergenic
1168070120 19:53944768-53944790 AAGGCAAAGAAGGGAAGATCTGG - Intergenic
1168431191 19:56282218-56282240 CAGCTGGAGAAGGGAGGGTCTGG + Intronic
927151531 2:20199010-20199032 CAGGTGCAGGAGGGAGGGGCTGG - Intergenic
928389388 2:30897572-30897594 CATGAGAAGAAGGGAGCTTCTGG + Intergenic
930569146 2:53062809-53062831 CAGGCAAAGAAAGCAGGGTAGGG - Intergenic
930991633 2:57663351-57663373 AAGAGGAAGAAAGGAGGGTCTGG - Intergenic
932410646 2:71545434-71545456 CCAGCGAGGAAGGGAGGGGCTGG - Intronic
932468013 2:71935769-71935791 GAGGGGAAGCAGGGAGGGACAGG + Intergenic
932485832 2:72083864-72083886 CTGGTGACGAAGGGAGGGTGGGG + Intergenic
932886324 2:75552440-75552462 CAGGGGAGTAAGGGAGGGGCAGG - Intronic
933648023 2:84828069-84828091 CAGGGGGAGAAGGGAGGAACTGG + Intronic
933894416 2:86797565-86797587 AAGGCCAACAAGGGAGGGTAGGG + Intronic
935122886 2:100197813-100197835 CAGGCGAGGAAGGGAGAGGGCGG - Intergenic
936985646 2:118309508-118309530 CAGGCGAGGGAGGGAGGGAAAGG + Intergenic
936992149 2:118377539-118377561 CAGGAGAAGAAGGAAGATTCTGG - Intergenic
942924083 2:181411492-181411514 CAGCTGAAGAAGGATGGGTCAGG - Intergenic
946158194 2:217820608-217820630 ACGGCGAAGAAGGGATGGTCAGG + Intronic
946804156 2:223453147-223453169 CAAGCCAAGAAGGGAGGGATGGG + Intergenic
947377370 2:229510328-229510350 CACGTGGAGAATGGAGGGTCCGG + Intronic
947642497 2:231714762-231714784 CAGGGAAGAAAGGGAGGGTCTGG + Intergenic
948574417 2:238940595-238940617 CAGGGAAAGAAGGGAGGCTCAGG - Intergenic
948752838 2:240142412-240142434 GTGGTGAAGAAGGGAGGGCCTGG + Intronic
1171400786 20:24871985-24872007 AAGGAGAAGAAGGGAGGGACAGG + Intergenic
1172444684 20:34986853-34986875 AGGGCAGAGAAGGGAGGGTCAGG - Intronic
1173746452 20:45441031-45441053 AAGGCATAGAAGGGAGTGTCTGG + Intergenic
1175889516 20:62310086-62310108 CGGGGTAGGAAGGGAGGGTCAGG + Intronic
1176040740 20:63064541-63064563 CAGGCGAAGTGGGGTGGGGCTGG + Intergenic
1176167037 20:63679763-63679785 GAGGAGAAGAAGGCAGGCTCGGG - Intronic
1176214735 20:63942649-63942671 CGGGGGCAGGAGGGAGGGTCAGG - Intronic
1176668562 21:9710550-9710572 CAGGCCAAGAAGGTAGGATGTGG + Intergenic
1177761728 21:25409183-25409205 CAGGGGATGAAGGGATGGTGTGG + Intergenic
1181409704 22:22710335-22710357 CAGGTGAACTAGGGAGGGTCTGG + Intergenic
1182109287 22:27711392-27711414 CAGGCAAGGAAGGGAAGGTCTGG + Intergenic
1182620079 22:31614053-31614075 CAGGCAAAGGAGAGAGGGTTTGG - Intronic
1184541952 22:45131992-45132014 CATGTGCAGAAGGGAGGGTTGGG - Intergenic
1184550323 22:45200954-45200976 CAGGTGAAGAAGGGGGGGAAGGG + Intronic
1184579818 22:45408418-45408440 AAGATGAAGGAGGGAGGGTCGGG - Intronic
1185310304 22:50150600-50150622 CAGGGGACGACGGGAGGGACTGG - Intronic
949318371 3:2782205-2782227 CAGGCCAAGAAGGGAAGCTGGGG - Intronic
949328834 3:2898519-2898541 GAGGCAGAGAAGGGAGGGACTGG - Intronic
949518348 3:4827170-4827192 CAGGAGCAGGAGGGTGGGTCAGG - Intronic
949831400 3:8218619-8218641 CAGGCGAGGAAGGGGGAGTGTGG - Intergenic
950716308 3:14850108-14850130 CAGGCGAAGCAGGAAGGGCCGGG - Intronic
950849105 3:16045161-16045183 CAGGTGAAGAAGGCAGTGGCTGG + Intergenic
951596351 3:24322533-24322555 CAGGCAAAGAAAGGAGTTTCAGG - Intronic
951816752 3:26763160-26763182 CAGGAGGAGAAGGTAGGGTTTGG + Intergenic
952294101 3:32046140-32046162 GAGGCCAAGGAGGGAGGATCAGG + Intronic
952717962 3:36500443-36500465 CAGGCGAAGGAGGTAGGGGAGGG + Intronic
953576671 3:44118192-44118214 CAGGTGAAAATGGGAGAGTCAGG - Intergenic
953628304 3:44589128-44589150 CAGGTGAACACTGGAGGGTCTGG - Intronic
954434742 3:50490029-50490051 CAGGTGGGGAAGGGATGGTCAGG + Intronic
955199696 3:56839841-56839863 CACCTGAGGAAGGGAGGGTCTGG + Intronic
955406810 3:58630833-58630855 CAGGCAAAGAAGGGAGGGAAGGG - Intergenic
959058983 3:101598760-101598782 GAGGCGAAGAAGGGGAGGTGGGG - Intergenic
959084942 3:101842148-101842170 CAGGGGAGGAAGGGAGGGTCAGG + Intronic
961340496 3:126213916-126213938 CAGGCACAGAAGGGAAGGACAGG + Intergenic
962386312 3:134935301-134935323 CAGGCGAAGAAGGGAGGGTCAGG + Intronic
962457244 3:135576009-135576031 CAGGTAAACAAGGCAGGGTCAGG - Intergenic
962853862 3:139327466-139327488 CAGGGGAAGAAGGCAGAATCTGG - Intronic
962906101 3:139804421-139804443 CAGGGGAAGAGGGAAGGATCAGG + Intergenic
966031389 3:175352298-175352320 GAGGAGAAGAAGGAAGGGTGAGG + Intronic
966510634 3:180758315-180758337 AAAGCAAAGAAGGGAGGGTTTGG + Intronic
968933553 4:3597374-3597396 CTGGAGCAGAAGGGAGGGGCGGG + Intergenic
968952849 4:3703521-3703543 CATGGGAAGAAGAGAGGGTGGGG + Intergenic
969268451 4:6081559-6081581 CAGACAGAGAAGGGAGTGTCAGG + Intronic
969666759 4:8561927-8561949 GAGGGGAAAAAGGGAGGGTGTGG + Intronic
970589399 4:17546298-17546320 CAGGCGAGAAAGGTAGGGCCAGG + Intergenic
970803562 4:20004282-20004304 GAGGCGGAGTAGGGAGGCTCAGG - Intergenic
971076376 4:23153757-23153779 CAGGCCATGAAGGGAAGGTGGGG + Intergenic
971367590 4:25989899-25989921 GAGGGGAAGAAGGGAGAGCCAGG - Intergenic
972349831 4:38226297-38226319 CAGGCAAAGATGGCAGGGGCTGG - Intergenic
972817274 4:42657522-42657544 CAGGCGAAGGCGAAAGGGTCTGG + Intergenic
973816516 4:54624517-54624539 CAGGCTGAGAAAGAAGGGTCAGG - Intergenic
979617824 4:122764077-122764099 CAGGAGAACAAGGAAGGCTCTGG + Intergenic
979746200 4:124216472-124216494 GAGGGGAAATAGGGAGGGTCTGG - Intergenic
983296617 4:165874816-165874838 GAGGCGTAGAAGGGAGGGGAAGG - Intronic
984331652 4:178328216-178328238 CAGGCCAAGAAGAGAGGCCCCGG + Intergenic
985279561 4:188271788-188271810 AAGAAGAAGAAGGGAGGGCCGGG - Intergenic
985988897 5:3538968-3538990 CAGGAGAGGAAGGGACGCTCGGG + Intergenic
986311987 5:6557682-6557704 CATCCGAAGAAGGGAGGGGAAGG - Intergenic
990504452 5:56430772-56430794 CAGGCAAGAAAGGAAGGGTCAGG - Intergenic
993502407 5:88678513-88678535 GAGGCGCAGAAGGGAGGGGAGGG - Intergenic
996164735 5:120210839-120210861 CAGGCGAAGAAAGGAGTTACAGG - Intergenic
996862911 5:128084720-128084742 CTGGGGAAGAAGGGAGGGCTGGG - Intronic
997641595 5:135452158-135452180 CATGGGGAGAAGGGAGGGCCTGG - Intronic
997815218 5:137010417-137010439 CTTGCGAGGAAGGGAGGGGCAGG + Intronic
998161919 5:139817787-139817809 TAGGAGAGGAAGGGAGGCTCAGG + Intronic
1001196192 5:169675636-169675658 CAGGCTAAAAAAGGAGAGTCAGG + Intronic
1001362753 5:171103892-171103914 GAGCCGAAGAAGGGTGGGTGGGG - Intronic
1001476060 5:172051733-172051755 CAGGCGAGGAAGAGAGTGACTGG + Intronic
1003088887 6:3084369-3084391 CTGACAAAGAAGGGAGGGTTAGG - Intronic
1003108195 6:3231345-3231367 CAGGCGGAGGAGGGAAGGCCTGG - Intronic
1003877871 6:10454147-10454169 GAGGCCAAGATGGGAGGATCAGG - Intergenic
1004979590 6:21008385-21008407 CAGGTTAAAAAGGCAGGGTCAGG + Intronic
1005512143 6:26520895-26520917 CGGGCGAGGGAGGGCGGGTCGGG - Intergenic
1006137164 6:31902121-31902143 CTGGTGAAGAAAGGGGGGTCGGG - Intronic
1006241121 6:32679830-32679852 CAAGCGAAGAAGGATGGATCCGG + Intergenic
1006337569 6:33428329-33428351 CAGCGGAGGACGGGAGGGTCGGG + Intronic
1006727413 6:36210012-36210034 CAGGGGTAGGAGGGTGGGTCTGG + Intronic
1006770331 6:36547533-36547555 CAGGGGGTGAAGGGAGGGGCAGG - Intergenic
1006814791 6:36842741-36842763 AACAGGAAGAAGGGAGGGTCAGG + Intergenic
1008048841 6:46879472-46879494 CAGGAGAGGGAGAGAGGGTCTGG - Intronic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011335929 6:86259687-86259709 TAGGAGAAGAAAGAAGGGTCAGG + Intergenic
1011814406 6:91171702-91171724 TAGGAGGAGAAAGGAGGGTCAGG + Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013607342 6:111762416-111762438 CAGGCCATGAAGGGAAGGTGGGG + Intronic
1015346399 6:132164475-132164497 CAGTGGAAGAAGGGAAGTTCTGG - Intergenic
1015715780 6:136190968-136190990 CAGGCGGAGAAGGGATGGAGAGG - Intronic
1016461628 6:144285214-144285236 GAGGCGGAGGAGGGAGGGTGGGG - Intergenic
1017810069 6:157978126-157978148 CAGGGGTAGAAGGCAGGGGCAGG - Intergenic
1018224483 6:161615257-161615279 GAGGAGATGAAGGGAGGGTTAGG - Intronic
1018650028 6:165985838-165985860 GTGGGGAAGAAGGGAGGGTGGGG - Intronic
1019055568 6:169220664-169220686 AAGGTGAAGTAGGGAGAGTCCGG - Intronic
1019280424 7:197046-197068 CAGGGGCAGAAGGGACGTTCTGG - Intronic
1019653009 7:2170799-2170821 CAGGCTGAGAAGGGAAAGTCGGG + Intronic
1020108186 7:5432434-5432456 CAGGTGAGGAAGGCAGGGGCAGG - Intronic
1020410521 7:7886991-7887013 TGGGTGAAGAAGGGAAGGTCAGG - Intronic
1023888480 7:44376811-44376833 GAGGTGAACATGGGAGGGTCAGG - Intergenic
1024325750 7:48107978-48108000 CACGAGAATAAGGGAGGGACAGG + Intronic
1024353104 7:48387627-48387649 CAGGCCGAGAAGGGAGAGTTAGG + Intronic
1025950602 7:66142325-66142347 CAGCCGAAGGAGGGAGGGTCTGG - Intronic
1026384680 7:69834365-69834387 CAGGTGAAGAAGGCAGAGTGAGG - Intronic
1027941039 7:84679577-84679599 GAGGCCAAGAAGGGCAGGTCAGG + Intergenic
1030148029 7:106376145-106376167 CAGGCCCAGCGGGGAGGGTCAGG - Intergenic
1031502815 7:122542159-122542181 CAGGGGAAGAAGGGAGGCACAGG + Intronic
1031923172 7:127615773-127615795 CAGGGCAGGAAGGGAGGGACTGG + Intronic
1032262331 7:130347451-130347473 CAGGGGAAGAAGGAAGGGAAAGG - Intronic
1033663095 7:143416986-143417008 CAGGTGAGGAAGGGAGGGTGGGG + Intergenic
1033718103 7:144024197-144024219 CAGGCGATGATGAGAGGTTCAGG - Intergenic
1034529312 7:151685530-151685552 GAGGCCGAGAAGGGAGGGGCTGG + Intronic
1034583478 7:152067288-152067310 CAGTACAAGAAGGGAGGGTGGGG - Intronic
1035179416 7:157078344-157078366 CACGCGAGGAAGGGAGGGCAGGG - Intergenic
1035373210 7:158392163-158392185 CAGGAGATGAAGGGAGGGAGAGG - Intronic
1035403426 7:158583611-158583633 CAGGCTCAGAAGGGATGGGCAGG - Intronic
1036408536 8:8477500-8477522 AAGGAGAAGAAGGCAGGGCCAGG + Intergenic
1036668054 8:10760807-10760829 CAGGTAAAGAAGGGTGGGTGGGG - Intronic
1037883780 8:22585817-22585839 CAGAGGAGGAAGGGAGGGTGTGG - Intronic
1038789926 8:30658925-30658947 CAAGCGAAGAACAGAGGGCCAGG + Intergenic
1039828669 8:41195507-41195529 CAGGAGGAGAGGGGAGGGACTGG + Intergenic
1040521376 8:48178974-48178996 AAGGAGAAGAAGGTGGGGTCTGG - Intergenic
1041095117 8:54342246-54342268 CAGGTGAGGAAGGGAGGGGTGGG + Intergenic
1042235959 8:66613339-66613361 CACGCGAAGAAGCGAGGGCGGGG + Intronic
1043163924 8:76879774-76879796 CAGGCCAAGAAGGGAGATGCTGG - Intergenic
1046162909 8:110390508-110390530 CAGTAGAAGAGGGGAGGGACAGG - Intergenic
1046586553 8:116155351-116155373 AACGCTAAGAAGGGAGGGTATGG + Intergenic
1046602725 8:116336484-116336506 CAGTGGAAGAGGAGAGGGTCTGG - Intergenic
1046984351 8:120370765-120370787 CAGGGGAGGAAGGGAGAGTAGGG - Intronic
1048426578 8:134329116-134329138 CAGAGGAAGAAAGGAGGGCCTGG - Intergenic
1048470944 8:134703741-134703763 CAGGGGAATAAGATAGGGTCTGG - Intronic
1049450027 8:142655619-142655641 CAGGAGCAGCAGGGATGGTCAGG - Intergenic
1051789495 9:20784404-20784426 CAGGCAAAGAAGAGTGGGTGTGG + Intronic
1052824890 9:33167358-33167380 CCGGCGGAGAGGGGAGGGGCGGG + Intergenic
1053651997 9:40178156-40178178 GAGGCGAAAGAGGGAGGGTATGG - Intergenic
1054800661 9:69345160-69345182 CAGGTGAAGGAGGCTGGGTCGGG + Intronic
1056827884 9:89889485-89889507 GAGGGGAAGGAGGGAGGGTATGG + Intergenic
1057092259 9:92268970-92268992 CAAGAGAAGAAGGGGAGGTCTGG - Intronic
1058648652 9:107154544-107154566 CAGACAAGGAAGGGAGGCTCAGG + Intergenic
1058983857 9:110194329-110194351 GAGGGGAAAAAGGGAGGGTCTGG + Intronic
1059710728 9:116865459-116865481 CAAGCGAAGAAGGCAGGATTTGG + Intronic
1061048187 9:128178638-128178660 CAGGGGAGGAATGAAGGGTCTGG + Intronic
1061061565 9:128253236-128253258 CAGCTGCAGAAGGGAGGGGCGGG - Intronic
1061246249 9:129402493-129402515 CAGGCGAAGGAGGCAGCGGCAGG - Intergenic
1061450610 9:130665128-130665150 CAGGAGGGGAAGGGAGGGGCCGG - Intronic
1061680053 9:132238538-132238560 CAGGCTAATAAGAAAGGGTCTGG + Intronic
1062204688 9:135329480-135329502 GAGCAGAAGAAGGGAGGGACAGG + Intergenic
1062309153 9:135926653-135926675 CAGCTGAAGGAGAGAGGGTCCGG - Intergenic
1203657304 Un_KI270753v1:10391-10413 CAGGCCAAGAAGGTAGGATGTGG - Intergenic
1186294008 X:8129058-8129080 GAGGGGAAAAAGGGAGGGTATGG + Intergenic
1187476178 X:19613059-19613081 CAGGGGCAGAAAGGAGGGGCAGG + Intronic
1189744671 X:44157689-44157711 CGGGAGAAGCAGGGAGGGACTGG - Intronic
1190215286 X:48475993-48476015 CGGTCCAAGAAGGGAGGGGCGGG + Intergenic
1192363504 X:70453489-70453511 CAGGAGACAAAGGGAGGCTCAGG + Intronic
1192759350 X:74079332-74079354 AAGGTGAAGAAGGGAGTGGCAGG + Intergenic
1194410771 X:93555242-93555264 GAGGGGAAAAAGGGAGGGTACGG + Intergenic
1195493725 X:105505079-105505101 CAGGTAAGGAAGGGAGGGTAGGG - Intronic
1199714403 X:150496109-150496131 CAACCGAAGAAGGGAGTGGCAGG - Intronic
1202023192 Y:20489718-20489740 CAGCCGTAGAAGGGATTGTCTGG - Intergenic