ID: 962389198

View in Genome Browser
Species Human (GRCh38)
Location 3:134957483-134957505
Sequence CTCGGATACCTTCCTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962389198_962389209 26 Left 962389198 3:134957483-134957505 CCACCAGGAGGAAGGTATCCGAG 0: 1
1: 0
2: 1
3: 15
4: 120
Right 962389209 3:134957532-134957554 GAGGCTGGGGAAAGCCATACAGG 0: 1
1: 0
2: 1
3: 18
4: 280
962389198_962389207 12 Left 962389198 3:134957483-134957505 CCACCAGGAGGAAGGTATCCGAG 0: 1
1: 0
2: 1
3: 15
4: 120
Right 962389207 3:134957518-134957540 TTGAATAAAGACTGGAGGCTGGG 0: 1
1: 0
2: 3
3: 22
4: 364
962389198_962389206 11 Left 962389198 3:134957483-134957505 CCACCAGGAGGAAGGTATCCGAG 0: 1
1: 0
2: 1
3: 15
4: 120
Right 962389206 3:134957517-134957539 CTTGAATAAAGACTGGAGGCTGG 0: 1
1: 0
2: 3
3: 19
4: 217
962389198_962389210 27 Left 962389198 3:134957483-134957505 CCACCAGGAGGAAGGTATCCGAG 0: 1
1: 0
2: 1
3: 15
4: 120
Right 962389210 3:134957533-134957555 AGGCTGGGGAAAGCCATACAGGG 0: 1
1: 0
2: 2
3: 28
4: 281
962389198_962389201 4 Left 962389198 3:134957483-134957505 CCACCAGGAGGAAGGTATCCGAG 0: 1
1: 0
2: 1
3: 15
4: 120
Right 962389201 3:134957510-134957532 ACTACCCCTTGAATAAAGACTGG 0: 1
1: 0
2: 0
3: 9
4: 110
962389198_962389202 7 Left 962389198 3:134957483-134957505 CCACCAGGAGGAAGGTATCCGAG 0: 1
1: 0
2: 1
3: 15
4: 120
Right 962389202 3:134957513-134957535 ACCCCTTGAATAAAGACTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 81
962389198_962389208 13 Left 962389198 3:134957483-134957505 CCACCAGGAGGAAGGTATCCGAG 0: 1
1: 0
2: 1
3: 15
4: 120
Right 962389208 3:134957519-134957541 TGAATAAAGACTGGAGGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962389198 Original CRISPR CTCGGATACCTTCCTCCTGG TGG (reversed) Intronic