ID: 962389748

View in Genome Browser
Species Human (GRCh38)
Location 3:134961254-134961276
Sequence CTGGAGAACCTGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962389744_962389748 13 Left 962389744 3:134961218-134961240 CCAGAGGATGCTGTGGCTGCAAG 0: 1
1: 0
2: 2
3: 30
4: 316
Right 962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG 0: 1
1: 0
2: 4
3: 19
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962389748 Original CRISPR CTGGAGAACCTGATGGAGCA TGG Intronic
900561558 1:3309610-3309632 CTGGAGAAGGTGCTGGAGCGGGG + Intronic
900590865 1:3459238-3459260 CTGGCGCACCTGCTGGAGCCTGG - Intronic
900889900 1:5442073-5442095 CTGGAAGACCTGATGGAGGGAGG + Intergenic
901013312 1:6213066-6213088 CTGGAGAAGGTCATGGAGCTGGG - Exonic
901098811 1:6703347-6703369 CTGGAAGAGCTGATGGACCATGG - Intergenic
901613120 1:10515064-10515086 CTGGAGAGCCCGCTGGAGGACGG - Intronic
902194983 1:14791690-14791712 CTGGAGATGATGATGGAGCTGGG + Intronic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
903024844 1:20420119-20420141 CTGGGGAGCATGATGGACCAAGG + Intergenic
904046699 1:27613351-27613373 CTGGAGAAGATGGGGGAGCAGGG + Intronic
904391013 1:30186009-30186031 CTGGCGGGCGTGATGGAGCATGG - Intergenic
904773115 1:32892107-32892129 CTGGAGAATCTGAAGGGCCAGGG + Intronic
905249586 1:36639317-36639339 CTGGAGAGCATGGTGGGGCAAGG - Intergenic
905913371 1:41669012-41669034 CTGGAGTTCCTGAGGGATCATGG - Intronic
906603868 1:47151411-47151433 CTGGCCACCCTGATGGGGCAGGG + Intergenic
907694501 1:56708826-56708848 CTGTTGAACCTGATAGGGCAGGG + Exonic
907798795 1:57743620-57743642 ATGGAGAACGTGTTTGAGCAGGG + Intronic
909303236 1:74039352-74039374 CTGGAGTACCTGAAGGAGATGGG + Intronic
912453995 1:109785787-109785809 TTGGAGAACCACATGTAGCATGG + Intergenic
912680580 1:111726545-111726567 CTGGGGAACCTGATGCTCCAGGG + Exonic
915310726 1:155004693-155004715 CTGGAGCAGCTGATGAAACAAGG + Intronic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
918955384 1:191200238-191200260 CTGGAGTACCTGAAGGAGATGGG + Intergenic
919031652 1:192250751-192250773 CTGGAGTACCTGAAGGAGACAGG - Intergenic
919895257 1:202005734-202005756 CTGGAGAGCCTGAAGAGGCAGGG - Exonic
919958466 1:202441589-202441611 CTAGAGAACCTTGTGAAGCATGG + Intronic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920968348 1:210720824-210720846 CTGGACAACATAAAGGAGCAGGG - Intronic
923989220 1:239416140-239416162 CTGGAAAATCTTATGAAGCATGG - Intronic
924780550 1:247143575-247143597 CTAGAGAAGCTGGTGGAACAGGG - Intronic
1063577906 10:7278519-7278541 CTGGAGCTCCTGATGGGACAGGG + Intronic
1063836692 10:10022615-10022637 CTGGAGCATCTGATGGAAAAGGG - Intergenic
1064755478 10:18568919-18568941 ATGGAGAACCAAATGGAGAATGG - Intronic
1064803504 10:19103625-19103647 CTGGAGCTCAGGATGGAGCATGG + Intronic
1065378759 10:25068044-25068066 CTGGGCAAGCTGATGGAGCCAGG - Intergenic
1065654297 10:27931492-27931514 CTGAAGGACCTGATTGAGCTGGG - Intronic
1068584562 10:58782700-58782722 CTGGAAAACCTGATTGAAGAGGG + Intronic
1069831608 10:71285371-71285393 CAGGAGAACCTCATGGTCCAGGG - Exonic
1071763888 10:88639910-88639932 CTAGAGAACCTTATGAAGGAAGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077238047 11:1492594-1492616 CTGGAGAAGCTGAGGTGGCAGGG + Intronic
1077327708 11:1970898-1970920 CTGCGGCACCTGATGGAGCCTGG + Intronic
1077978518 11:7275155-7275177 AGGGAGAATCTGCTGGAGCAGGG - Intronic
1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG + Intronic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081782047 11:45719810-45719832 GGAGAAAACCTGATGGAGCATGG - Intergenic
1082745467 11:56956416-56956438 CTGGAGAACCTGAAGTTCCAGGG - Intergenic
1082747497 11:56980985-56981007 CTGGAGAACCTGAGGTTCCAGGG - Intergenic
1083783503 11:64930607-64930629 CTGGAGCTCCTGCTGCAGCAGGG - Intronic
1083942350 11:65903190-65903212 CTGGGGCAGCTGAGGGAGCAGGG + Intergenic
1085299518 11:75450078-75450100 CAGGAGAGGCCGATGGAGCAGGG + Intronic
1085380769 11:76115978-76116000 CTGAAAAACTTCATGGAGCATGG + Exonic
1088684349 11:112272432-112272454 CTGGAAAACATGAGTGAGCAAGG - Intergenic
1089179223 11:116569461-116569483 CTGGAGAGCTTCAGGGAGCAGGG + Intergenic
1089342048 11:117764709-117764731 TTGCAAAGCCTGATGGAGCATGG - Intronic
1089582342 11:119489294-119489316 CTGGGGGTCCTGATGGACCAGGG + Intergenic
1090866620 11:130706460-130706482 GTTGAGATCCTAATGGAGCAAGG - Intronic
1202810690 11_KI270721v1_random:26078-26100 CTGCGGCACCTGATGGAGCCTGG + Intergenic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1093151909 12:15631601-15631623 TTGGAGGAGGTGATGGAGCAGGG + Exonic
1096228385 12:49883676-49883698 CCTGAGACCCTGAGGGAGCAGGG + Intronic
1097151218 12:56981228-56981250 TTGGAGAACCTAGTGGAGCATGG + Intergenic
1099055914 12:77840436-77840458 GAGGAGAATATGATGGAGCAAGG + Intronic
1100278165 12:93091488-93091510 CAGGAGAACCTGATGGGTAAGGG - Intergenic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1103162185 12:118738709-118738731 ATGCAGAGCCTGATGGAGAAGGG - Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1103379043 12:120479631-120479653 CTGAAGAACCAGATGGTGCTAGG + Intronic
1103907089 12:124333272-124333294 CTGGAGACCTGGATGGAGAAAGG + Exonic
1104649823 12:130523539-130523561 CTGGAGCTCCTGATGGGGAAGGG - Intronic
1104757909 12:131280404-131280426 CTGCAGACCCTGATGGGTCAGGG - Intergenic
1105206541 13:18230563-18230585 GTGGAGAACCTGAAGGGCCAAGG + Intergenic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107432194 13:40350183-40350205 CTGGAGAACAGCATGGAGCAAGG - Intergenic
1108836676 13:54558435-54558457 CCCAACAACCTGATGGAGCATGG + Intergenic
1109708361 13:66129851-66129873 CTTGAGATCCTGATAGAGCTGGG + Intergenic
1111007099 13:82262467-82262489 CTGGAGAACCTAATAATGCAGGG - Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1112609954 13:100946284-100946306 GTGGGGAACTGGATGGAGCAAGG - Intergenic
1113986983 13:114325132-114325154 CTGGAGATCCTGCTGGACTACGG - Exonic
1114058588 14:18999066-18999088 CTGAAGTACCCCATGGAGCACGG + Intergenic
1114103959 14:19402688-19402710 CTGAAGTACCCCATGGAGCACGG - Exonic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1115546010 14:34465324-34465346 CAGGAGAAGCTAATGGAGGAAGG + Intergenic
1115762111 14:36584920-36584942 TTCGAGAACCTGAGGGAGGAGGG - Intergenic
1117536455 14:56707558-56707580 GAGGAGAATCTGCTGGAGCAGGG - Intronic
1121115391 14:91339389-91339411 CTGGAGGACTTGATGGGGCTGGG + Exonic
1121545170 14:94757906-94757928 CTGGAGAGCAACATGGAGCATGG + Intergenic
1122509598 14:102255652-102255674 CTGGAGAAGCTTATGGAGAGTGG - Intronic
1123124405 14:105935898-105935920 CTGGAGATCCAGATAGGGCATGG + Intergenic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1124941942 15:34226373-34226395 CTGGTGAGCCTGATGAAGAAAGG - Intronic
1125894176 15:43288061-43288083 CTGGAGGACTTGAAGAAGCAGGG + Intronic
1128214965 15:65928134-65928156 CTAGAGAATATGATGGAGAAGGG - Intronic
1128254224 15:66185251-66185273 CTGCAGAACTTGAGGCAGCAGGG - Intronic
1128443200 15:67732726-67732748 CTGGAGCTCCATATGGAGCAGGG - Intronic
1132042745 15:98538652-98538674 TTGGAGAACTAGAAGGAGCAAGG - Intergenic
1133111478 16:3550489-3550511 CTGGAGAACCTGCAAGAGAAGGG + Exonic
1135293149 16:21257387-21257409 CTGGACAACGTGATGGTTCAGGG + Intronic
1136050512 16:27646821-27646843 CTGGGTGACCTCATGGAGCAAGG - Intronic
1136999223 16:35214908-35214930 CTGGCCAACCAGATGCAGCAAGG - Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1138868046 16:60848105-60848127 TGGGAGAACCTGATGAAGCTGGG + Intergenic
1140829145 16:78735330-78735352 CTGGAGAACCTGATGACCAATGG - Intronic
1142424951 16:89997172-89997194 CAGGAGAACCTCATGGACCCGGG + Intergenic
1144807209 17:17976030-17976052 CTGGAGAAACTCCTGGTGCAGGG - Intronic
1145268294 17:21391085-21391107 CTGGAGGACATGATGGAGATGGG - Intronic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1147901064 17:43785150-43785172 CTGGAGACCCTGGTGGAGCAGGG + Exonic
1149557520 17:57584653-57584675 CTTGAGAACTTGTTGGAGAAAGG + Intronic
1150800505 17:68278252-68278274 CTGAAGTGCCTGATGGAGGATGG - Exonic
1151220355 17:72606926-72606948 CTGGAGAACCTGATTGTCCTGGG - Intergenic
1152328541 17:79657019-79657041 GTGGAGACCCTGTTGGAACAGGG - Intergenic
1152734564 17:81991123-81991145 CTGAAGACCGTGAGGGAGCAGGG + Intronic
1152757038 17:82091392-82091414 GTGCAGAAGCTGCTGGAGCAGGG - Exonic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1152935172 17:83132534-83132556 CTGGGGAACCTGGTGGGGCGGGG - Intergenic
1152941906 17:83177223-83177245 CTGCAGAGCCTGCTGGAGCCGGG + Intergenic
1153749753 18:8216900-8216922 CTGGAGAATCTGTTGAAGGAGGG + Intronic
1156549351 18:37999176-37999198 CTGCAGAACCTGAGAGGGCAGGG + Intergenic
1160908822 19:1465516-1465538 CTGGAGCACCTGGAGAAGCAGGG + Exonic
1161443206 19:4304201-4304223 CTGGAGGAGCTGTTGGAGCCTGG + Intergenic
1161542592 19:4861114-4861136 TTGGAGGGCCTGAGGGAGCAGGG - Intronic
1161741985 19:6026934-6026956 CTGAAGGACCTGATGGAGGTGGG + Intronic
1161841020 19:6680341-6680363 GTGGAGAAACTGAAGGATCAAGG + Intronic
1162024862 19:7888252-7888274 CTGGGGAAACTGAGGGAGCTGGG - Intergenic
1162148807 19:8630709-8630731 CTGGAGAGCCAGGAGGAGCAAGG + Intergenic
1163532582 19:17859301-17859323 CATAAGAACCTGAGGGAGCAGGG - Intergenic
1164558702 19:29273545-29273567 CTGGAGCACATTATGGAGGAGGG - Intergenic
1165111136 19:33502988-33503010 CTGGAGAACCCCACGGAACACGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1168254401 19:55157830-55157852 CTGGTGATCCAGCTGGAGCAGGG - Intronic
1168680891 19:58314999-58315021 GTGGATAACCTCAAGGAGCACGG - Exonic
925211862 2:2056257-2056279 CTGGAGAGCCTGAGGGACCCAGG - Intronic
925595506 2:5551977-5551999 CTGGAGAGGGTGAGGGAGCAGGG + Intergenic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
929558966 2:42943723-42943745 CTGGAGAAGTTGATGGGGCTTGG + Intergenic
930064408 2:47316835-47316857 CAGGAGAACCTGTTGAACCAGGG - Intergenic
930912131 2:56641698-56641720 CTGGAGAACTTATTGGAGAAAGG + Intergenic
931389556 2:61829354-61829376 CAGGAGAACCTGAAATAGCAAGG + Intronic
931494961 2:62795494-62795516 CTTAAGAACCTTATGGAGAAAGG - Intronic
931788031 2:65639252-65639274 CTGGGGCAGCTGGTGGAGCAGGG - Intergenic
932716602 2:74104804-74104826 CTGCAGAAACTGATGAACCAAGG - Exonic
933129645 2:78656346-78656368 CTGGAGCACCTGAAGGAGACAGG + Intergenic
933702057 2:85262771-85262793 CTGGAGAACTTATTGGAGGATGG - Intronic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
937864096 2:126735118-126735140 CCCGAGACCCTGAAGGAGCAAGG - Intergenic
938477054 2:131626337-131626359 CTGAAGTACCCCATGGAGCATGG + Intergenic
939377778 2:141392086-141392108 CTGGTTAAGCTGATGAAGCAAGG + Intronic
939895447 2:147785608-147785630 CTAGAGAACCTGTTGGATAAGGG - Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940647083 2:156402968-156402990 CTGGTGGAACTGAGGGAGCAGGG + Intergenic
941552453 2:166934279-166934301 CTGGAGAAGCCCATGTAGCAAGG + Intronic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
942087758 2:172459207-172459229 GTAGAGAACGTGGTGGAGCACGG + Intronic
942449039 2:176097879-176097901 CTGGGGAACCTGATCGAGGGAGG - Intergenic
943477202 2:188372223-188372245 CTGGAGAACTAGATGCAGCTGGG - Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
947603597 2:231469399-231469421 CTGGGGGACCTGGTGGAGCTGGG - Intronic
949002979 2:241628037-241628059 CTGGAGAGGCTGGTGGAGCTGGG - Intronic
1168856361 20:1011984-1012006 CTGTAGAACCTGGTGGTACAGGG + Intergenic
1170228779 20:14021901-14021923 CTGGAGAACCTTAGGGGGAAGGG + Intronic
1171091638 20:22290861-22290883 CTGGAGACCCTGATGGACTGAGG + Intergenic
1172225521 20:33302798-33302820 CTGGAACACGTGAGGGAGCAGGG + Intronic
1175521879 20:59607039-59607061 CTTGGGAACTTGATGGAGGAAGG + Intronic
1175780128 20:61676897-61676919 CTGGAGGACCTGATGGGGTGAGG + Intronic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1177513764 21:22121993-22122015 GGGGAGGACCTGAAGGAGCAGGG - Intergenic
1178373349 21:32046314-32046336 CTGGAGAACGTGATGATTCAGGG - Intergenic
1179487096 21:41717328-41717350 GTCGAGACCCTGATGGAGGAAGG - Intergenic
1180477073 22:15721685-15721707 CTGAAGTACCCCATGGAGCACGG + Intergenic
1180759410 22:18188145-18188167 GTGGAGAACCTGAAGGGCCAAGG - Intergenic
1180769720 22:18372445-18372467 GTGGAGAACCTGAAGGGCCAAGG - Intergenic
1180776609 22:18490221-18490243 GTGGAGAACCTGAAGGGCCAAGG + Intergenic
1180809337 22:18747590-18747612 GTGGAGAACCTGAAGGGCCAAGG + Intergenic
1180827657 22:18875401-18875423 GTGGAGAACCTGAAGGGCCAAGG - Intergenic
1180883784 22:19225195-19225217 ATGGAGAAACTTATGGAGCCCGG - Intronic
1181195332 22:21181512-21181534 GTGGAGAACCTGAAGGGCCAAGG + Intergenic
1181524566 22:23472900-23472922 GTGGAGAACCTGAAGGGCCAAGG - Intergenic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181786599 22:25231638-25231660 CTGCAGTACCTGCTGGAGAAGGG + Exonic
1181818765 22:25459450-25459472 CTGCAGTACCTGCTGGAGAAGGG + Intergenic
1181845308 22:25702970-25702992 GTGGAGAATCTGCTGGTGCACGG + Intronic
1182336681 22:29588181-29588203 CTGGAGAAGCCCATGTAGCAAGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182740443 22:32563608-32563630 CTGGAAAAGTTGATGGATCAGGG + Intronic
1183489532 22:38109159-38109181 CTGGAGAACCTGGTGTACCTGGG - Exonic
1184057391 22:42061508-42061530 CTGGAAAACCTTCTGGAGGATGG - Intronic
1203231549 22_KI270731v1_random:113629-113651 GTGGAGAACCTGAAGGGCCAAGG - Intergenic
1203277757 22_KI270734v1_random:101398-101420 GTGGAGAACCTGAAGGGCCAAGG - Intergenic
949115444 3:315718-315740 CTGGAGAACCTGAGGGAGTCAGG + Intronic
949732677 3:7131881-7131903 CTGGAGAAAATGATGTGGCAAGG - Intronic
950367829 3:12500804-12500826 TATGAGAACGTGATGGAGCAAGG + Intronic
952642703 3:35616792-35616814 CTGGAAAACATGTTGGAGCATGG - Intergenic
953215841 3:40917350-40917372 CAGGAAATCCTGATGGAGAATGG - Intergenic
953461017 3:43081241-43081263 CTGCAGATCCTGATGGAGGGCGG - Exonic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
955322732 3:57985874-57985896 GTGGAGACCAGGATGGAGCAGGG + Intergenic
955331129 3:58048344-58048366 CTGGAGAACAGGGTGGAGCCTGG + Intronic
955484511 3:59422368-59422390 GTGGACAAGCTTATGGAGCATGG - Intergenic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
959681091 3:109097436-109097458 CTGGAGAACATGCTGTACCAAGG + Intronic
960944525 3:122957031-122957053 CTGGAGAAGCTGGTGGAGAGAGG + Intronic
961121875 3:124379635-124379657 CTGGAAAACCTCATGGTTCATGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
963573470 3:147027964-147027986 CTGAAGAAACTTATGGAACAAGG - Intergenic
964748401 3:160032858-160032880 CTGGAGAACCTGCTGGAAAACGG - Intergenic
965955502 3:174364207-174364229 CTTTAGAACCTGATGAGGCAGGG - Intergenic
966034260 3:175391462-175391484 TTGGAGAAGCTCATGTAGCAAGG + Intronic
966748472 3:183300319-183300341 CTGGAGAACCTGAGAAAGCTCGG + Intronic
966877507 3:184331550-184331572 CTGGAGAAGCTGCTGAAGGAGGG + Exonic
968960836 4:3742733-3742755 CTGCTGAACATGATGGTGCAGGG - Intergenic
973147763 4:46849203-46849225 GGGGAGAAACTGATGGCGCAAGG - Intronic
975689377 4:76949488-76949510 TTCCAGCACCTGATGGAGCAGGG + Intergenic
976342491 4:83960758-83960780 GTGGAGAACCTGAAAGAGCAGGG - Intergenic
978611380 4:110544973-110544995 CTGCAGAACCTCATTGAGCCAGG - Intronic
983732042 4:171007883-171007905 CTGGAGACCATGTTGGAGCTTGG + Intergenic
984092258 4:175388578-175388600 CTGGAGTACCTGAAGGAGACAGG + Intergenic
985902353 5:2806431-2806453 CAGGAGAACCTGCTTGGGCAGGG + Intergenic
985990550 5:3556805-3556827 CTGGAGCCCCTCATGGAGCTTGG + Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987456281 5:18151043-18151065 CTGGAGCAACTTATGGAGCTGGG - Intergenic
988065763 5:26227909-26227931 CTGGAGACCCTGGAGGAGCTGGG - Intergenic
988730716 5:33970156-33970178 CTGCAGCAGCTGCTGGAGCAAGG - Intronic
989458042 5:41664906-41664928 ATGGAGAACCTGATAGACCTTGG - Intergenic
989682459 5:44045692-44045714 CTGGAGTACCTGAAGGAGACAGG - Intergenic
990954067 5:61326631-61326653 CTGGAGATTCTGATTCAGCAGGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
996876746 5:128249068-128249090 CTGGAGCACATGCTGGAGAAAGG - Intergenic
997165877 5:131659896-131659918 CTGAAGTACCCCATGGAGCATGG - Intronic
997824464 5:137093850-137093872 ATAGAGAACCTGGGGGAGCAGGG + Intronic
999442511 5:151613465-151613487 GCGGAGAACCTCATGGAGCAAGG - Intergenic
999942923 5:156563911-156563933 CTGAAGAACTTGAGGGAGTAGGG - Intronic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000863856 5:166488878-166488900 ATGGAGACCCTGAGGGAACAGGG - Intergenic
1001989086 5:176101052-176101074 CTGGAAGACCTGGAGGAGCATGG + Exonic
1002227784 5:177737085-177737107 CTGGAAGACCTGGAGGAGCATGG - Exonic
1002382220 5:178839142-178839164 CTGGAGGCCCTGAAGTAGCAAGG + Intergenic
1003248909 6:4407168-4407190 CTGGAGTACCTGAAGGAGATGGG + Intergenic
1005501440 6:26432049-26432071 CTTGAGGTCCTGATTGAGCAAGG + Intergenic
1005630536 6:27703262-27703284 CTGGAGAACTTTGTGGAGAAGGG - Intergenic
1007354977 6:41308051-41308073 CCTGAGAACTTCATGGAGCATGG - Intergenic
1007947541 6:45839717-45839739 CTGCAGGAGGTGATGGAGCAGGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1010234184 6:73561423-73561445 CAGGAGAACCTCTTGGAGCTGGG + Intergenic
1012518690 6:100093610-100093632 CTTGAGCACTTGCTGGAGCAGGG + Intergenic
1012991547 6:105931379-105931401 CTGGAAAACCTGATGTTTCAAGG + Intergenic
1015073920 6:129131930-129131952 CAGAAGAACGTGATGGAGAAGGG - Intronic
1015527290 6:134185844-134185866 CTGGAGAACCTGATGTCCGAAGG + Intronic
1015603524 6:134933392-134933414 CTGGACACCAAGATGGAGCAGGG - Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016353772 6:143195614-143195636 CTGGCCACCCTGAGGGAGCACGG + Intronic
1018645429 6:165943570-165943592 CTGGAGAACCTGGTGTTCCAGGG + Intronic
1021486698 7:21175717-21175739 CTTGGGAAGCTGATGGAGAAGGG + Intergenic
1022145727 7:27538550-27538572 GAAGAGAACCTGATGCAGCATGG + Intronic
1022384313 7:29887565-29887587 CTGGAGAACCAGTGTGAGCAGGG + Intronic
1025995495 7:66524890-66524912 CGGGAGATCCTGCTGGGGCAAGG + Intergenic
1027745770 7:82071985-82072007 CTGGACAACATCATGGACCAGGG + Intronic
1028141389 7:87279301-87279323 CTAGAGGACCTGATGAAGCTGGG + Intergenic
1028475081 7:91244565-91244587 CAGGAGATCCTGAGGCAGCAGGG - Intergenic
1028997522 7:97117572-97117594 CGGGAGGACCTGATTGTGCAAGG + Exonic
1029216558 7:98954589-98954611 CTGCAGAACCTGCTGGTGCCTGG - Intronic
1029450704 7:100640653-100640675 CTCGAGAACAGGATGGGGCAGGG + Intronic
1030322949 7:108188250-108188272 CTGGAGCACCCCAAGGAGCATGG + Intronic
1032081642 7:128861762-128861784 CTCGAGAAGCTGAGGCAGCAGGG - Intergenic
1033269208 7:139915587-139915609 CTGGACAGCCTGGTGGAGAAGGG + Intronic
1036047284 8:5158011-5158033 GTGGGGAATCTGATGAAGCAGGG - Intergenic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1036563095 8:9914070-9914092 CTGGAGAACGGCATGGAGCATGG - Intergenic
1036726435 8:11224879-11224901 TTGGAGAACATTATGGAGGAAGG - Intergenic
1038398295 8:27262967-27262989 CTGGGGACCCTCATGGAGCCTGG + Intergenic
1039850340 8:41359170-41359192 CTGGCTAACCTGATTTAGCAGGG + Intergenic
1040748554 8:50676248-50676270 CTGGAGTACCTGAAGGAGACAGG - Intronic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1048670262 8:136711388-136711410 CTGGAGAACATGTTGGAAGATGG - Intergenic
1049930055 9:447644-447666 ATGGAGAAACTGATGAACCATGG - Intronic
1051192963 9:14534232-14534254 CTAGAGCACCTGAGGGAGCCAGG - Intergenic
1051336617 9:16071434-16071456 CTGGAAAGTCTGAGGGAGCAAGG - Intergenic
1055693122 9:78855671-78855693 CTGAAGAACCAGAAGTAGCAAGG + Intergenic
1056162038 9:83906387-83906409 CTGGAGAACCTGCCAGAGGAGGG - Intronic
1056719414 9:89059633-89059655 GTGGAGGACGTGATGGAGGATGG + Intronic
1057745133 9:97745363-97745385 CTAAAGGACCAGATGGAGCATGG - Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058835453 9:108855578-108855600 CTGGTGAACCCGCTGAAGCACGG - Exonic
1059906483 9:118992167-118992189 CTGAAGAAGCTCAGGGAGCAGGG + Intergenic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1062170791 9:135133583-135133605 CTGGAGAGCCTGCGGAAGCAAGG + Intergenic
1062491264 9:136806225-136806247 CCGGGGCACCTGATGGAGCTAGG - Exonic
1186078255 X:5903599-5903621 CCCCAGATCCTGATGGAGCAAGG - Exonic
1186501388 X:10053496-10053518 CTGGAGAACATGCTGGAACCTGG + Intronic
1188286811 X:28336558-28336580 CTGTAAAAGCTGCTGGAGCAGGG + Intergenic
1189624674 X:42883773-42883795 CTGGAGAACATGATGATGCATGG + Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1190640697 X:52481203-52481225 CTACAGAAAATGATGGAGCAGGG + Intergenic
1190646975 X:52531662-52531684 CTACAGAAAATGATGGAGCAGGG - Intergenic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1192034312 X:67546311-67546333 CTGGAGAACCCGCTGGACTACGG + Exonic
1192207048 X:69103231-69103253 CTGGTGAACCTGGGGGAGAAGGG - Intergenic
1192439992 X:71167256-71167278 CCTGAGATCCTCATGGAGCAGGG + Exonic
1193475459 X:81959097-81959119 CTGGGCAGCCTGATGTAGCAGGG + Intergenic
1196422263 X:115535058-115535080 CTGGCCAACATGATGGAACATGG - Intergenic
1196683334 X:118490714-118490736 CTGGAGAAGCTCATGAGGCAAGG + Intergenic
1196717892 X:118827607-118827629 CTGGAGCACGTGAAGGAACATGG + Intergenic
1197202618 X:123761479-123761501 CTGAATAACCTTGTGGAGCAAGG - Intergenic
1197602244 X:128543865-128543887 CTTGAGAGCCACATGGAGCAGGG - Intergenic
1197762451 X:130037475-130037497 CTGAACATCCTGCTGGAGCACGG + Exonic
1198377942 X:136058105-136058127 CTGGAGAATCTGATGGACCCAGG - Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199963208 X:152796187-152796209 TTGGAGTACTTAATGGAGCAAGG + Intergenic
1200150570 X:153949436-153949458 CTGGAGGCCCTGCTGGTGCAGGG + Intronic
1201517088 Y:14829975-14829997 CCCCAGATCCTGATGGAGCAAGG + Exonic
1202075359 Y:21031950-21031972 CTTGAGAACCACAGGGAGCAGGG - Intergenic