ID: 962390673

View in Genome Browser
Species Human (GRCh38)
Location 3:134969535-134969557
Sequence GTGATGAAGGCCTTCATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962390671_962390673 13 Left 962390671 3:134969499-134969521 CCAATTCTTAGACACGCTAGTTT 0: 1
1: 0
2: 0
3: 7
4: 55
Right 962390673 3:134969535-134969557 GTGATGAAGGCCTTCATTTAAGG 0: 1
1: 0
2: 0
3: 9
4: 148
962390670_962390673 28 Left 962390670 3:134969484-134969506 CCACACAGGGGAGAGCCAATTCT 0: 1
1: 1
2: 0
3: 15
4: 135
Right 962390673 3:134969535-134969557 GTGATGAAGGCCTTCATTTAAGG 0: 1
1: 0
2: 0
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962390673 Original CRISPR GTGATGAAGGCCTTCATTTA AGG Intronic
902395509 1:16130397-16130419 GTGATGAAAGCCATCAATGATGG - Exonic
902692440 1:18118293-18118315 GTGATGAACGCCTTCCTTTGGGG - Intronic
906119247 1:43377157-43377179 GTGGTGAAGGGCCTCCTTTAGGG + Intergenic
906783220 1:48590918-48590940 ATGATGAATGGCTTCATGTATGG - Exonic
909198318 1:72655731-72655753 GGGATGAATGCCTTTATTAAAGG + Intergenic
910573448 1:88731799-88731821 GTGACCAAGTACTTCATTTAGGG - Intronic
911771113 1:101743897-101743919 GCTTTGAAGGCCTTCATTTGGGG - Intergenic
912176142 1:107159827-107159849 GTGATGAGTGTCTTCATTCAGGG + Intronic
912986631 1:114439517-114439539 TTGATGGAGGGCTTCATTTTGGG - Intronic
915620027 1:157076010-157076032 GTGATTAAGGAATACATTTATGG - Intergenic
923043476 1:230336969-230336991 GTGATGAGGCCCTTCCTTGAGGG - Intronic
924266855 1:242291325-242291347 TTGATTAAGGCCTTCCTTGATGG + Intronic
924820995 1:247490630-247490652 GTCATGAAGGACCACATTTATGG - Intergenic
1062984719 10:1757521-1757543 GTGATGACAACCTTCATCTAGGG + Intergenic
1065111529 10:22444718-22444740 GGGAAGAAGGCTTTCATTTGAGG + Intronic
1065274820 10:24075218-24075240 GGGAGGACTGCCTTCATTTAGGG - Intronic
1066132890 10:32411458-32411480 GTGATGATGGCTTTCATCTATGG - Intergenic
1066717965 10:38307178-38307200 TTGATTAAGGCCTTCCTTGATGG - Intergenic
1069175144 10:65280968-65280990 GTGATGAAATCATTCATATATGG + Intergenic
1072251230 10:93583849-93583871 TTGATGAAGGCTCACATTTATGG - Intronic
1073947675 10:108769626-108769648 TTGATTTAAGCCTTCATTTAAGG - Intergenic
1085841411 11:80015707-80015729 CCAATGACGGCCTTCATTTATGG - Intergenic
1090203773 11:124873846-124873868 GTGATAGAGGCCTTCAGGTATGG + Exonic
1090312582 11:125755538-125755560 GTGATAAATGCCCTAATTTAAGG - Intergenic
1093040677 12:14376195-14376217 GGGATGAAGGCATTTATTTTGGG + Intronic
1093825686 12:23685166-23685188 GAAAAGAAGGCCTTCTTTTAGGG - Intronic
1101203002 12:102456349-102456371 GAGAAGAAAGTCTTCATTTAGGG + Intronic
1103770298 12:123317414-123317436 CTGCTGAAGGACTTCATTTAAGG - Intronic
1104458485 12:128934779-128934801 GTCAAGAAGCCCTTCATTCAAGG + Intronic
1110763399 13:79254588-79254610 GTGAGAAAGGCCTTTAGTTAGGG - Intergenic
1111927795 13:94481645-94481667 GTCATGATAGCCTGCATTTAAGG - Intergenic
1117252177 14:53948901-53948923 TTGATGAAGGCCTTCACATTGGG + Intergenic
1120032771 14:79661490-79661512 TTGAGGAAAGCCTTCATTTTGGG + Intronic
1120347619 14:83310208-83310230 GTGATGAAGGCAATGATATATGG - Intergenic
1122396118 14:101433263-101433285 GTGATGAAGGTCAACATTAATGG + Intergenic
1123505121 15:20934592-20934614 GTGATAATTGCCTTCATTTTAGG - Intergenic
1123562364 15:21508288-21508310 GTGATAATTGCCTTCATTTTAGG - Intergenic
1123598609 15:21945575-21945597 GTGATAATTGCCTTCATTTTAGG - Intergenic
1125131928 15:36292184-36292206 GTCATGAAGGGCTACATTGATGG - Intergenic
1126277841 15:46905246-46905268 GTAATGAATACATTCATTTAAGG + Intergenic
1129312301 15:74721247-74721269 AGGATGAAGGCCTCCATATAGGG + Exonic
1130972542 15:88744755-88744777 GTGAGGATGGCATTCATATACGG + Intergenic
1202970711 15_KI270727v1_random:235435-235457 GTGATAATTGCCTTCATTTTAGG - Intergenic
1132824217 16:1895131-1895153 CTGATAAAGGCCTACCTTTATGG - Intergenic
1139346069 16:66304653-66304675 GTTATGACCGCCTTCATTTTAGG - Intergenic
1143846864 17:9778832-9778854 GTGGAGAACGCCTCCATTTAGGG - Intronic
1144306264 17:13971905-13971927 GTCATGAAAGCCTGTATTTATGG - Intergenic
1146241129 17:31227501-31227523 GTGATAATTGCCTTCATTTTAGG + Exonic
1149983551 17:61330470-61330492 GGAATGAAGGCCTGCATTTGGGG - Intronic
1150265329 17:63828588-63828610 GTGAGGAAGGGCATCATTGAGGG + Intronic
1150324384 17:64244364-64244386 GTCAGGAAGGTCTTCACTTAGGG + Intronic
1151071184 17:71214100-71214122 CTGATGAAAGCCTTCATATTGGG - Intergenic
1151115124 17:71726957-71726979 AGGATGCAGGCCTTCATTTGTGG - Intergenic
1152249585 17:79204696-79204718 GTGGTGAGTGCCTTCACTTAGGG + Intronic
1153337115 18:3936271-3936293 GTGATGAAGGCCTTGATCACTGG - Intronic
1158988562 18:62844972-62844994 GTGATGGAGCCCTGCAGTTAGGG + Intronic
1159256908 18:65958510-65958532 GTGATGAAGTCCTTCGTCTCTGG + Intergenic
1164433451 19:28208037-28208059 GAGAGGAAGGCCTTCACTCAAGG - Intergenic
1165176450 19:33934013-33934035 TTGATGATGGCTTTCATTTCTGG + Intergenic
926511417 2:13784901-13784923 GTGGTGAAGGTATGCATTTATGG + Intergenic
929062542 2:37938105-37938127 GTTTTGAAGGCCTTTATTGAAGG + Intronic
929131588 2:38579766-38579788 GTTATGAAGGTCTTTATTTGGGG + Intronic
929279636 2:40063932-40063954 CAGATGAAGGCCATTATTTATGG - Intergenic
929910923 2:46089020-46089042 GAGAGGAAGGCATTCATTTAGGG - Intronic
933217946 2:79651903-79651925 GTGAAGGGGGCCCTCATTTACGG + Intronic
933858001 2:86436605-86436627 GTGAGGAGGGCATTCATGTAGGG - Intergenic
934885944 2:98025121-98025143 GTGGTGAAAGCATTAATTTAAGG - Intergenic
940491545 2:154368434-154368456 GGGATGAAGGCCTTTTTTAATGG + Intronic
940531241 2:154879607-154879629 TTGATGGTGGCCTTCATTTTGGG + Intergenic
943655922 2:190508925-190508947 CTAATGAAAGCCTTCATTCAAGG + Exonic
947150446 2:227109795-227109817 GTGATAAATTCCTTCATTTAGGG + Intronic
1169676998 20:8165573-8165595 ATGATGAAGGCCTTGAATTCGGG + Intronic
1169771921 20:9210424-9210446 CTGATGAGGGCTTTCATTTAGGG + Intronic
1171117105 20:22534478-22534500 GTGATGATGGTCTTCGTTAACGG + Intergenic
1171218600 20:23372917-23372939 GTGGTGGAGACCTTTATTTAAGG + Exonic
1173116069 20:40244267-40244289 GTGATAAAGGTCTGCTTTTATGG - Intergenic
1178946422 21:36951686-36951708 TTGATCAAGGCATTCATTGAAGG - Intronic
1182764157 22:32746531-32746553 GGGATGAAGGCTTTCATATTTGG + Intronic
1183682625 22:39342267-39342289 GTCATGATGGGCTTCATTTGGGG + Intergenic
949263476 3:2129913-2129935 GTTTTGAAAACCTTCATTTAAGG - Intronic
950146838 3:10656187-10656209 GAGATGAAGGCCTTGATGTGTGG + Intronic
950696693 3:14706222-14706244 GTGATGAATGGATTCATATACGG - Intronic
950994712 3:17482082-17482104 GTTCTGAAGGCGTTTATTTAAGG - Intronic
951707915 3:25562377-25562399 GAGATGAAGCCTTTTATTTATGG - Intronic
951743399 3:25949219-25949241 ATGATTAAGGTCTTCATTGATGG + Intergenic
952713899 3:36458779-36458801 GTGTTGAAGTCCTTCATTTGGGG - Intronic
955083304 3:55677698-55677720 GTGAAGAAGACCCTCATCTATGG - Intronic
959123389 3:102260364-102260386 TTGATGAAATCCTTCTTTTAGGG + Intronic
962110311 3:132438739-132438761 CTGCTGAATGCCTTTATTTAGGG + Intronic
962384008 3:134918296-134918318 TGGAAGAAGGGCTTCATTTAGGG + Intronic
962390673 3:134969535-134969557 GTGATGAAGGCCTTCATTTAAGG + Intronic
962390928 3:134972058-134972080 GTGATGAGGACCTTCACTTAAGG - Intronic
962757447 3:138476592-138476614 GAGATGAACACCTTTATTTAAGG + Intronic
964435283 3:156644674-156644696 GTGATGAATCTCTACATTTAAGG - Intergenic
964628385 3:158781448-158781470 GTGATGGAGGCAATCATATAAGG - Intronic
964911684 3:161790298-161790320 ATGAGGAAGGCATTCAATTAAGG - Intergenic
964922720 3:161917449-161917471 GTCAGGAAGGAATTCATTTATGG + Intergenic
966119844 3:176509363-176509385 GTGACAATGGCCCTCATTTAAGG - Intergenic
966196648 3:177320546-177320568 GTGATGAAGGCCTTCTGAGATGG - Intergenic
968532022 4:1097138-1097160 GGGCTGGAGGCCTTCATTCATGG - Intronic
968604752 4:1529361-1529383 GTGCTGAAGGCCAGCATTTGCGG - Intergenic
970512563 4:16795639-16795661 GAGATAAAGGCCTCCATTCATGG - Intronic
970966567 4:21935034-21935056 CTGATGAAGGCCTTTGCTTATGG - Intronic
972418619 4:38867066-38867088 TTGAGGAAGGCCTTCATATGTGG + Intergenic
972728339 4:41767065-41767087 CAGATGATGGCCTTCATTTCTGG + Intergenic
975406505 4:73996490-73996512 TTGAAGAAGGCCAGCATTTATGG - Exonic
977151443 4:93518118-93518140 GTGATGCAGGCCTTCCTGGAAGG - Intronic
978109630 4:104947077-104947099 GGGATGAATGCCTTTATTGATGG + Intergenic
979731198 4:124024527-124024549 GGGATTAGGGCCTTCATTAAAGG + Intergenic
980929083 4:139168461-139168483 GAGATGATAGCCTACATTTAAGG + Intronic
982327210 4:154140799-154140821 GCTATGGAGACCTTCATTTATGG + Intergenic
985165956 4:187094367-187094389 GTGGAGAAGCCCTTCATTCAAGG + Intergenic
986594001 5:9401669-9401691 GTGGTCAAGGCATTAATTTATGG - Intronic
987884222 5:23792375-23792397 TTGATTCAGGCCTTTATTTAGGG + Intergenic
988618911 5:32802515-32802537 GTGATGAAGGCCTTGTTTAGGGG - Intergenic
990872166 5:60444110-60444132 GTGAAAAGCGCCTTCATTTAAGG + Intronic
991310588 5:65236959-65236981 GTGATGTATGCTTTCATTTCTGG - Intronic
992849112 5:80786359-80786381 GTAATGAAGACCTACCTTTATGG + Intronic
993681811 5:90887329-90887351 GTGATGAAGCCCTCCATAAAAGG - Intronic
995794975 5:115931493-115931515 GAGATGAAAGCCTTAATTGAGGG - Intergenic
996710282 5:126536589-126536611 GTGATGAGGGCACTCATGTAAGG + Intergenic
997254222 5:132415487-132415509 ATTATGATTGCCTTCATTTATGG + Intronic
997406154 5:133648514-133648536 TTGATGAATGCCTACTTTTATGG - Intergenic
998000083 5:138618230-138618252 GTTGTGAAGGCCTTCATGCAAGG + Intronic
999260817 5:150237802-150237824 GTAATAAGGGCCGTCATTTATGG - Intronic
999512759 5:152269934-152269956 GTGATGAAGGTTTTCAATGACGG - Intergenic
1002875180 6:1203941-1203963 ATGATGAAGGCATTCACTGAGGG + Intergenic
1003512117 6:6790359-6790381 GTGATCAAGGCCTGCCTCTAGGG + Intergenic
1010057896 6:71586784-71586806 TTGATAAAGGCCTATATTTAAGG - Intergenic
1010569149 6:77456814-77456836 GTGATGAGGGGATCCATTTATGG - Intergenic
1012122079 6:95381297-95381319 GTGTCTGAGGCCTTCATTTAAGG + Intergenic
1014747028 6:125212716-125212738 CTGATGAAGACCTGCATTCATGG - Intronic
1018937810 6:168284953-168284975 GTGATGAAGGCACCCATTTGTGG - Intergenic
1020421084 7:8006273-8006295 GTGATTAAGGACCACATTTAGGG + Intronic
1021246494 7:18269487-18269509 GTGGTGAAGGTCTTCTTTTCTGG - Intronic
1022051206 7:26675069-26675091 GTGATGAAGGCCTGAATTAGTGG - Intronic
1022768788 7:33446552-33446574 GAGAATGAGGCCTTCATTTAAGG + Intronic
1023595274 7:41822896-41822918 GGGGTGAAGGCTTTCATTGATGG - Intergenic
1026133601 7:67640516-67640538 GTGATGTAGGCCCTGATTTAGGG + Intergenic
1027264815 7:76488530-76488552 GTCCTGAATGCCTTCACTTATGG + Intronic
1027316188 7:76986633-76986655 GTCCTGAATGCCTTCACTTATGG + Intergenic
1029915439 7:104204929-104204951 CTAATGAAAGCGTTCATTTAAGG - Intronic
1030841296 7:114357635-114357657 GTGATGAAGGCATTTACTGAAGG - Intronic
1030909914 7:115234082-115234104 GTGATGCACCCCTTCATTAATGG + Intergenic
1034856492 7:154553169-154553191 GTGATGGAGGTCTTAAATTAAGG + Intronic
1035616768 8:1007714-1007736 GTGATGGAAACCTTCATATAAGG + Intergenic
1039260792 8:35769350-35769372 GTGAAGAAGGCCCACAGTTAAGG - Intronic
1041433587 8:57812520-57812542 GTGATAAAGTCTTTCATATAGGG + Intergenic
1042574275 8:70200507-70200529 ATGAAGAAGGCATTCATTAAGGG + Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1045531548 8:102989677-102989699 CTGATGAAGGCCTTCTTCTCTGG + Intergenic
1187229870 X:17410612-17410634 GAAATGAAGGCCTGCATTTTGGG - Intronic
1188648506 X:32599353-32599375 ATGATCAAGGCCTTTATTCATGG - Intronic
1194147450 X:90280992-90281014 GTCATGAAGGCCTGTATATAAGG + Intergenic
1194698704 X:97087848-97087870 GAGATATAGGCCTTCATTTGGGG - Intronic
1198215742 X:134552716-134552738 TTAATGAAGGCCTTGAGTTAGGG + Intergenic
1198962182 X:142194673-142194695 GGGAGGGAGCCCTTCATTTATGG - Intergenic
1200493852 Y:3857754-3857776 GTCATGAAGGCCTGTATATAAGG + Intergenic