ID: 962390861

View in Genome Browser
Species Human (GRCh38)
Location 3:134971460-134971482
Sequence ATGGATGGGTGGATGGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2674
Summary {0: 1, 1: 4, 2: 44, 3: 595, 4: 2030}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962390850_962390861 28 Left 962390850 3:134971409-134971431 CCTGGGTTCTGCTCTGGAATTTA 0: 1
1: 0
2: 1
3: 14
4: 215
Right 962390861 3:134971460-134971482 ATGGATGGGTGGATGGAGCGAGG 0: 1
1: 4
2: 44
3: 595
4: 2030
962390849_962390861 29 Left 962390849 3:134971408-134971430 CCCTGGGTTCTGCTCTGGAATTT 0: 1
1: 1
2: 0
3: 24
4: 232
Right 962390861 3:134971460-134971482 ATGGATGGGTGGATGGAGCGAGG 0: 1
1: 4
2: 44
3: 595
4: 2030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962390861 Original CRISPR ATGGATGGGTGGATGGAGCG AGG Intronic