ID: 962391981

View in Genome Browser
Species Human (GRCh38)
Location 3:134980023-134980045
Sequence TGCATAGCAAAACACCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962391979_962391981 14 Left 962391979 3:134979986-134980008 CCTTAACTGGAAAGATTGTGTTT 0: 1
1: 0
2: 0
3: 22
4: 266
Right 962391981 3:134980023-134980045 TGCATAGCAAAACACCTCAATGG 0: 1
1: 0
2: 5
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962391981 Original CRISPR TGCATAGCAAAACACCTCAA TGG Intronic
901479487 1:9515061-9515083 TGCATTGAATAACAACTCAAAGG + Intergenic
901900743 1:12359925-12359947 TGCTTTGCAAAATACATCAAGGG - Intronic
903104461 1:21063608-21063630 TGCACAGCAAAACAACTTGAAGG + Intronic
903814317 1:26053573-26053595 GGCCAAACAAAACACCTCAATGG + Intronic
907556667 1:55350233-55350255 AAAATAGAAAAACACCTCAAAGG + Intergenic
908792054 1:67792479-67792501 TATATATCAAAACACCCCAATGG - Intronic
909390561 1:75115945-75115967 TTAAAACCAAAACACCTCAAAGG - Intergenic
912241264 1:107912334-107912356 TGCATAAGAAAACACCACCAAGG + Intronic
912827712 1:112921489-112921511 TGCATAGAAAAACACATGGAAGG + Intronic
912835029 1:112988644-112988666 TGCATAGCAAAGTACATAAAAGG - Intergenic
913460078 1:119076053-119076075 AGCATAGCAAAACAATTCCAGGG + Intronic
913579548 1:120212650-120212672 TGCATAGCAAATCACCTCAGTGG + Intergenic
913628625 1:120685738-120685760 TGCATAGCAAATCACCTCAGTGG - Intergenic
914561482 1:148824077-148824099 TGCATAGCAAATCACCTCAGTGG + Intronic
914611353 1:149306131-149306153 TGCATAGCAAATCACCTCAGTGG - Intergenic
914700598 1:150129511-150129533 TTCATAGCAAAAGATCTAAAAGG - Intronic
914765382 1:150632928-150632950 TGCAAAGAAAAGCACCTCCACGG - Intergenic
917958291 1:180122705-180122727 TGAAGAGCAAAACCCTTCAAGGG - Intergenic
918750819 1:188266997-188267019 TTAATATAAAAACACCTCAAGGG - Intergenic
920273738 1:204787983-204788005 TTCACAGCCAAACAGCTCAAAGG + Intergenic
921330851 1:214033931-214033953 TGCAAACCCATACACCTCAAGGG - Intronic
922320925 1:224486000-224486022 TGGATAATAAACCACCTCAAAGG - Intronic
1063932254 10:11040768-11040790 TGAATGGAAAAACACCTGAAAGG - Intronic
1065330189 10:24587900-24587922 GGCATAGCATAACACCACTATGG + Intronic
1065398213 10:25264630-25264652 TGTGTAACAAACCACCTCAAAGG - Intronic
1065603991 10:27397045-27397067 TGCATAGAAAAGCCCCTGAATGG + Intergenic
1073702133 10:105939256-105939278 GACATAGCAAAACATCTGAAAGG + Intergenic
1075534382 10:123257692-123257714 TCCATAGGAAAACAGCCCAAGGG + Intergenic
1075690376 10:124389906-124389928 TGCATAGCTAAACACAGAAAAGG - Intergenic
1075694112 10:124420606-124420628 TGCAGAGCAAGACACCAAAAGGG + Intergenic
1079390758 11:20019946-20019968 AGTACAGGAAAACACCTCAAAGG + Intronic
1083112043 11:60420369-60420391 TGCATAACAAATTACCACAAAGG + Intergenic
1084550438 11:69838271-69838293 TGCATAACAAACCACCCCAAAGG + Intergenic
1086900329 11:92360312-92360334 TGCATAGCAAAGAATTTCAAAGG - Intronic
1092614935 12:10208329-10208351 TATATAGCAAACCACCTCAAAGG - Intergenic
1093518906 12:20024898-20024920 TGGAAAGCAAAACACTACAAAGG - Intergenic
1095323830 12:40863504-40863526 TGTATAGCAAATAACCTCTAAGG + Intronic
1095686782 12:45045417-45045439 TTCATAGCAAAGAATCTCAAAGG + Intronic
1098342459 12:69466942-69466964 TGTTTAACAAAACACCTTAATGG + Intergenic
1098487229 12:71035333-71035355 TGCCTAGCAAAGCATCTCAATGG + Intergenic
1100909678 12:99344675-99344697 TGCATAGAAAATCACCTCTAAGG - Intronic
1101631308 12:106497757-106497779 TGTCTAGCAACACACCTAAACGG - Intronic
1102449651 12:113031426-113031448 TACATAGCAAAATACCACAGTGG - Intergenic
1102499642 12:113342860-113342882 TGCATAGCAAAATATTTCATAGG - Intronic
1105234791 13:18539551-18539573 TGCATAGAAACACAACTGAAAGG - Intergenic
1105564851 13:21534620-21534642 TGCATAGCAAAAATACTCAAGGG + Intronic
1106493795 13:30255262-30255284 TGCAATGCAAATCACCTCAGAGG - Intronic
1110158472 13:72346651-72346673 TGCATAAGAAAACACTTGAAAGG + Intergenic
1111073302 13:83198934-83198956 TGAATGGCAAAACAATTCAAAGG - Intergenic
1111270897 13:85883566-85883588 TGCATAGCTAACCAGCTGAAGGG - Intergenic
1111672049 13:91344190-91344212 TGCATAGCAAACTTCCTTAAGGG + Intergenic
1111744973 13:92256392-92256414 TACATAGCCAAATTCCTCAAAGG + Intronic
1112072723 13:95872942-95872964 TCCTTAGCAAAACCCCACAAGGG + Intronic
1112639672 13:101258659-101258681 TGCATAGCAGCACATCACAAAGG - Intronic
1117792905 14:59359558-59359580 TGCAGTGCAAACTACCTCAATGG - Intronic
1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG + Intergenic
1120175020 14:81284337-81284359 TGCAAAGGAAAACTTCTCAAAGG + Intronic
1121954275 14:98200044-98200066 AGCACAGTAAACCACCTCAAAGG - Intergenic
1125132548 15:36300579-36300601 TGGAAAGGAAAACACCACAAGGG + Intergenic
1126508750 15:49440814-49440836 TATATAACAAAACAACTCAATGG - Intronic
1128976738 15:72159856-72159878 GCCATAGCAAAACAACCCAAGGG + Exonic
1130661091 15:85831832-85831854 TGCAAAGCAAAAGATCTCATTGG - Intergenic
1138892490 16:61162049-61162071 TGCATCGCAAAATACCTAATGGG - Intergenic
1143280454 17:5750421-5750443 TGCATAGCACATTACCTCACTGG + Intergenic
1145815465 17:27792291-27792313 AGCACAGAAAAACACCTCGAGGG + Intronic
1146896803 17:36547958-36547980 TGCAGAGCAAAACACCTGTTGGG + Intronic
1149084304 17:52696004-52696026 TGCATATAAAAACCCCTTAATGG + Intergenic
1150567655 17:66356334-66356356 TGCATAACAAAACACCATATAGG + Intronic
1151338314 17:73453676-73453698 TGCGTAACAAAACAGCTCAGTGG - Intronic
1153041940 18:820959-820981 TGCACAGCACACCATCTCAAAGG - Intergenic
1153748199 18:8201921-8201943 TAAACAGCAAAACACATCAAAGG - Intronic
1158541879 18:58364537-58364559 TACATATCAAATCACCTGAAGGG + Intronic
1159230592 18:65603707-65603729 TTTATAGCAAAACTCCTCACAGG + Intergenic
1159899672 18:74034209-74034231 TGCATCACAAAACGCCCCAAAGG - Intergenic
1160080006 18:75717270-75717292 TGCAGAGAAAAACACCTAAAGGG + Intergenic
1161762387 19:6183573-6183595 TCCATCTCAAAACACCTCCATGG + Intronic
1163920407 19:20283453-20283475 TGCAAAGGAAAGCACCTCCACGG + Intergenic
1165397575 19:35574464-35574486 TGCAAAGAAAAGCACCTCCACGG - Intergenic
1165606504 19:37109608-37109630 TGCAAAGAAAAGCACCTCCACGG - Intronic
1167991128 19:53361772-53361794 TGCAAAGAAAAGCACCTCCACGG + Intergenic
1168142553 19:54398817-54398839 TGTGTAACAAATCACCTCAAAGG + Intergenic
925473065 2:4183439-4183461 TGGTTAGCAAAAGAGCTCAAGGG + Intergenic
925555264 2:5123782-5123804 TGCCTAGCAAAGGATCTCAAAGG + Intergenic
925838727 2:7970531-7970553 TGCTTAGCAAAATACCTTAGTGG + Intergenic
926297045 2:11576626-11576648 TGCATAGCAGCACACATCACGGG + Intronic
927681217 2:25140655-25140677 TGCATTGCAAAACACCCTGATGG - Intronic
929700521 2:44159180-44159202 TACATAGCTAAACATGTCAAGGG + Intergenic
932913677 2:75831989-75832011 AGAAAAGCAAAACACCACAATGG - Intergenic
941994275 2:171586684-171586706 TCAATGGCAAAATACCTCAATGG + Intergenic
942182188 2:173390565-173390587 TACACAGCAACACACCTCAACGG + Intergenic
942797791 2:179841855-179841877 TTAAAAGCAAAACACCCCAATGG + Intronic
943327649 2:186521193-186521215 TGCAAAGAAAAGCACCTCCACGG + Intergenic
944346684 2:198674594-198674616 TGCATGGTAAAAGACCTCAAAGG - Intergenic
948414951 2:237796394-237796416 AACAAAACAAAACACCTCAAAGG + Intronic
1168934504 20:1651743-1651765 TGCATAGCACAACACAAGAAAGG - Intronic
1169169159 20:3450192-3450214 TGCATAGAAGAACAGATCAATGG + Intergenic
1169924871 20:10772516-10772538 TTCATATCAAATCACCTCTAGGG - Intergenic
1170382740 20:15779412-15779434 AGCAAAGCAAAATATCTCAATGG - Intronic
1170539220 20:17371173-17371195 TGCATAGCATAACCCCACAAAGG + Intronic
1172673843 20:36653517-36653539 TGCTTAGCAGGACACCTCCATGG + Exonic
1173176469 20:40768448-40768470 TGCAAAACAAAGCACCTAAATGG - Intergenic
1176778783 21:13167839-13167861 TGCATAGAAACACAACTGAAAGG - Intergenic
1185290715 22:50025751-50025773 TGCAAAGCAAAATATCTGAAAGG + Intronic
949497760 3:4649220-4649242 TTCATAGAAAAACAGCTCAATGG - Intronic
950774206 3:15335777-15335799 TGCATAGCAAAAGGCCTGGAAGG + Intronic
952333195 3:32383573-32383595 TGCATATCAAAGCAACCCAAAGG - Intergenic
955064311 3:55521448-55521470 TGCATAGCATTTCACCTCCAAGG - Intronic
956060427 3:65343066-65343088 TGAAGAGGAAAACACCCCAAGGG - Intergenic
960307755 3:116082982-116083004 TACATAGCTAAACACGTCAGAGG - Intronic
960607076 3:119517610-119517632 TGCATAGGAAATTACCTAAAGGG + Intronic
961122865 3:124387947-124387969 TGCCTAGCAAATCACTTAAAGGG - Intronic
962391981 3:134980023-134980045 TGCATAGCAAAACACCTCAATGG + Intronic
963167863 3:142223953-142223975 TACAAAGAAAAACACCTCTAAGG + Intronic
967252652 3:187558163-187558185 TGCAAAACAAAAGACCTGAAAGG - Intergenic
968297732 3:197590601-197590623 TGACTAGGAAAACAACTCAAAGG + Intergenic
972903047 4:43708592-43708614 TAAATAGCACAACACTTCAATGG - Intergenic
975669443 4:76766194-76766216 TGAATAGTAAAACACTTAAATGG + Intronic
975686719 4:76922977-76922999 TCCATAGCAAAACCCCACTAAGG - Intergenic
975762028 4:77629988-77630010 TGCAAAGAAAAAGATCTCAAAGG - Intergenic
980763978 4:137274532-137274554 TGATTAGTAAAACACCTCAAGGG + Intergenic
981451145 4:144899271-144899293 TGCATAGCAAAACCCCTAAAAGG - Intergenic
982982813 4:162163041-162163063 TGCATAACAACACATCTAAATGG + Intronic
986016550 5:3762541-3762563 TGCAGAGCAACACACCTTCACGG + Intergenic
986612327 5:9581812-9581834 TGTATCACAAAACACCTGAAGGG + Intergenic
986856046 5:11870079-11870101 TGCCTAGCAAAAGAGCCCAATGG + Intronic
986938620 5:12921101-12921123 AGCATAGCAAACCTCCTCATGGG + Intergenic
987224229 5:15822833-15822855 TGCATAGTAAATCACCTAGAAGG + Intronic
991601806 5:68358471-68358493 TGTTTAGCAAAACACCCTAAAGG - Intergenic
993009669 5:82465726-82465748 TTCACATCAAAACACTTCAATGG + Intergenic
993034444 5:82741515-82741537 TGTATAGGAAAGCACCTCTAGGG + Intergenic
993889642 5:93457896-93457918 TGCAAAGAAAAGCACCTCCATGG - Intergenic
995480198 5:112585740-112585762 TGAATAGCAAAAGCCCCCAAAGG + Intergenic
998562778 5:143186752-143186774 TGCACAGCAAAGCTCCCCAATGG - Intronic
998630232 5:143889975-143889997 TGCCTAGGAAATAACCTCAATGG + Intergenic
1001076151 5:168629476-168629498 TGCATAGAAATACAACTGAAGGG + Intergenic
1002690642 5:181047508-181047530 TGCAGAGAAAAATACCTGAAAGG - Intronic
1003555272 6:7133844-7133866 TCCATAGAAAACCACCTAAAAGG - Intronic
1005785617 6:29242788-29242810 TGCAAAGCAAAAGACTTCAAGGG - Intergenic
1008879310 6:56364528-56364550 TCCATAGCAAACCATCTGAATGG + Intronic
1009918064 6:70021179-70021201 TTCCTAGCAAAACTCCGCAATGG - Intronic
1010167635 6:72935681-72935703 TTTATAGCAAAACCTCTCAAAGG + Intronic
1011400311 6:86954174-86954196 TGTATAGCCAGACACCACAAGGG + Intronic
1012291835 6:97465759-97465781 TGAATAGCAAAATATTTCAAGGG - Intergenic
1014192505 6:118513968-118513990 TGTATGACAAAACAGCTCAAAGG + Intronic
1016413596 6:143809670-143809692 TGCATGGAAAAACATCTAAAAGG - Intronic
1022803556 7:33798994-33799016 TCAATAGCAAAAGACCTCAAAGG + Intergenic
1023491273 7:40744733-40744755 TGCTCAGCAAAACTCCTTAAGGG - Intronic
1024693178 7:51825236-51825258 TGCATAGGAAAGCATCTCAGGGG + Intergenic
1024988520 7:55216643-55216665 TGCATAGCACAAAACCCCAAAGG + Intronic
1026623761 7:71974538-71974560 AGCAGAAGAAAACACCTCAAGGG - Intronic
1029586089 7:101472545-101472567 TGCTTAGCACAACCCCTCCATGG - Intronic
1030805440 7:113912552-113912574 TGCAGGGGAAAAGACCTCAAGGG - Intronic
1032521545 7:132549385-132549407 TTCCTACCAAGACACCTCAAGGG - Intronic
1035391237 7:158506437-158506459 TGCAGAGCAAAGCACTTCAGAGG + Intronic
1044264915 8:90170165-90170187 TGCATAGCAGAACTCCTAACAGG + Intergenic
1044462422 8:92460871-92460893 TGCCCAGCAAGACACCTCCATGG + Intergenic
1044481754 8:92698737-92698759 TGCATGGCAAAACTCCTTAAAGG - Intergenic
1055371386 9:75603344-75603366 TGCAAAGCTGTACACCTCAAGGG - Intergenic
1055524278 9:77114845-77114867 TGCATACCAAACTACCCCAAAGG + Intergenic
1055752646 9:79524141-79524163 TGCATAAAGAAACACCTTAAAGG - Intergenic
1057727242 9:97576594-97576616 TGCATAGAAACACAACTCATTGG + Intronic
1058817378 9:108696998-108697020 TGCTCAGCAAAACACATAAACGG - Intergenic
1059089947 9:111345712-111345734 TATTTAGGAAAACACCTCAAGGG + Intergenic
1059774002 9:117456463-117456485 TGCCTAACAAACCACCTCAAAGG - Intergenic
1186585023 X:10864054-10864076 CAAATATCAAAACACCTCAAAGG - Intergenic
1188292966 X:28411402-28411424 TTTATAGCAAAACACATAAAAGG + Intergenic
1189610911 X:42733249-42733271 TGCATAACAAATTACCTTAAAGG - Intergenic
1192489215 X:71559580-71559602 GGCATAACAGAACACCTGAAAGG - Exonic
1192576903 X:72250180-72250202 TGCATACCAATATATCTCAAAGG + Intronic
1194889425 X:99359956-99359978 TCCATAGCAAAACACACAAAAGG - Intergenic
1195429141 X:104768579-104768601 GGCAACCCAAAACACCTCAACGG - Intronic
1196141441 X:112267163-112267185 TTCTTAACAAAACTCCTCAAAGG + Intergenic
1196715864 X:118810477-118810499 TCCATAGCAAAGCTCTTCAAAGG + Intergenic
1197093240 X:122563725-122563747 TACATAGAAAAACAACTCACCGG + Intergenic
1200856122 Y:7940417-7940439 TGCTTGGCACAACACCTAAATGG - Intergenic
1202259886 Y:22959246-22959268 TGCTTGGCACAACACCTAAATGG + Intergenic
1202412872 Y:24592990-24593012 TGCTTGGCACAACACCTAAATGG + Intergenic
1202457909 Y:25077080-25077102 TGCTTGGCACAACACCTAAATGG - Intergenic