ID: 962399689

View in Genome Browser
Species Human (GRCh38)
Location 3:135047800-135047822
Sequence AACCAAAATGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 11, 2: 46, 3: 104, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962399689_962399691 7 Left 962399689 3:135047800-135047822 CCATGTCTGGAGACATTTTGGTT 0: 1
1: 11
2: 46
3: 104
4: 375
Right 962399691 3:135047830-135047852 CTGGAGAGTATATTGACAAATGG 0: 1
1: 0
2: 1
3: 44
4: 705
962399689_962399692 10 Left 962399689 3:135047800-135047822 CCATGTCTGGAGACATTTTGGTT 0: 1
1: 11
2: 46
3: 104
4: 375
Right 962399692 3:135047833-135047855 GAGAGTATATTGACAAATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962399689 Original CRISPR AACCAAAATGTCTCCAGACA TGG (reversed) Intronic
900793707 1:4695066-4695088 AACCAAAAATGTTCCAGACATGG - Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
900956901 1:5891911-5891933 AAGCACAATGTGTCCGGACAGGG + Intronic
901756894 1:11446867-11446889 CACCAAAAAGGCTCCAGAAATGG - Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902869203 1:19303364-19303386 CACCAAAATCCCTCCAGCCATGG - Intergenic
903530423 1:24026117-24026139 TACAAAAATGTAGCCAGACATGG - Intergenic
905217152 1:36416870-36416892 ATGTAAAATGTCTCCAGCCAGGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907741287 1:57168589-57168611 AACCAAAAAATCTCAAGACCAGG - Intronic
907913533 1:58847966-58847988 AACCTAAATTTCTCCTGAAAAGG + Intergenic
908208577 1:61876642-61876664 AATCAAAATGTCTCCAGATGTGG + Intronic
908839732 1:68266899-68266921 ATACAAAATGTCTCCGGAGATGG + Intergenic
909490788 1:76224207-76224229 AAATAAAATCTCTCCAGACAAGG - Intronic
909727628 1:78854502-78854524 AATCAAAATCTCTACAGATAGGG + Intergenic
910397817 1:86809251-86809273 CACCAAAATGTGTCCAGAATTGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911038221 1:93572065-93572087 AAGCAAGATGTCCCCGGACAGGG + Intronic
911202157 1:95056352-95056374 AAGCAAAATGTGGCCAGGCACGG + Intronic
911289335 1:96037959-96037981 AACAAAACTGTCTCCTGCCATGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
912855045 1:113160368-113160390 AACCAATATTTCTCATGACATGG - Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
919369882 1:196709689-196709711 GACCAAAATGTCTTGTGACAAGG - Intronic
920332462 1:205219960-205219982 TACCAAAATGTCTCAAGAATAGG - Intergenic
920737958 1:208552404-208552426 AAACAACCTGTCTCCAGCCACGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921245676 1:213236590-213236612 AAACAAAATGTATTCAGTCAAGG + Intronic
923402813 1:233631520-233631542 AACCATAATGTCTACAAGCAGGG - Intronic
924252228 1:242144204-242144226 AACCAAAATTTCTGCAGGCTGGG + Intronic
924252237 1:242144280-242144302 AACCAAAATTTCTGCAGGCTGGG + Intronic
924388983 1:243530250-243530272 AACCATACTGTCTGCAAACATGG + Intronic
1063322023 10:5059835-5059857 CGCCAAAATGTGTCCAGAAATGG + Intronic
1064748718 10:18503611-18503633 AAACAAAATGTTTCCATATAAGG - Intronic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065808244 10:29415515-29415537 AAATAAAATGTCAACAGACATGG - Intergenic
1065876305 10:30000276-30000298 AACCAAAAGGACTGCAGGCAAGG - Intergenic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069137631 10:64784336-64784358 CACCAAAATGTGTCCAGAATTGG + Intergenic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1070542884 10:77429419-77429441 AACTAAAATGTCTCCCAACATGG + Intronic
1071415449 10:85437050-85437072 ATCCAAAATGTCTGCAGGAATGG - Intergenic
1072372001 10:94773216-94773238 CACCAAAATGTGTCCAGAATTGG + Intronic
1072894115 10:99350963-99350985 AACCAGATTGTCTCCATACATGG + Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077991887 11:7419557-7419579 AACAAAAATGTCTCAAGGCGGGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079522750 11:21347882-21347904 GACCAAATTGTGTCCAGAAAAGG + Intronic
1081145726 11:39561234-39561256 CACCAAAATGTGTCCAGAATTGG - Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083283447 11:61641947-61641969 AACCTAAATGTCTAACGACAAGG + Intergenic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084471528 11:69362335-69362357 AACAAAGAAGTCTCAAGACATGG - Intronic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085060772 11:73444689-73444711 AACCTAAATGTCTACCAACAGGG + Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087200362 11:95338669-95338691 AACAAAAATGCTGCCAGACAGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093741875 12:22698577-22698599 ATCCAAAATGTTGCCAGAAATGG + Intergenic
1094090319 12:26642788-26642810 ACCCAAAATGTTTCCAATCAGGG + Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095513716 12:42982720-42982742 CACCAAAATGTCTCTAAATAAGG + Intergenic
1096970285 12:55660003-55660025 TACCACAATGTCCCCAGATATGG + Intergenic
1098066351 12:66621466-66621488 AAACAAAATGTATACATACAAGG - Intronic
1098444816 12:70555702-70555724 GACCTAAAAGTCTCCAGAAATGG - Intronic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1099087583 12:78264312-78264334 AACCACTATGTCCCAAGACATGG + Intergenic
1099682774 12:85848980-85849002 AACAAAAATTTATCCAGGCATGG - Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1101987622 12:109460173-109460195 AAACAAAATGCTTCTAGACATGG - Intronic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104247104 12:127054488-127054510 TATTAAAATGTATCCAGACAGGG + Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105023268 12:132831798-132831820 AACCAAAATGTCCTCTGACATGG + Intronic
1105790521 13:23793760-23793782 AACCATCATTTCTCCAGACCTGG - Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107509299 13:41066876-41066898 TACCACATTGTCTCCAGAAATGG + Intronic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109611005 13:64764451-64764473 AAAGAAAATGTCTCCACTCAGGG - Intergenic
1110185598 13:72671343-72671365 AACCCAAATGTCCCCCAACAGGG + Intergenic
1110677183 13:78262826-78262848 AGCCATAGTGACTCCAGACAGGG + Intergenic
1111360932 13:87175411-87175433 AATCAAAATGTCTACAGAGTTGG + Intergenic
1111617765 13:90683042-90683064 AACCAAAGTGTCTACCTACAGGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112518820 13:100078747-100078769 CACCAAAATGTGTCCAGAATTGG - Intergenic
1112785878 13:102951389-102951411 AAAGATAATGTCTCCAGGCAGGG - Intergenic
1112849461 13:103686613-103686635 AACCAAGATGTCAACAGACTTGG - Intergenic
1113039579 13:106090358-106090380 AACCAAAATGTTCCCAAATAGGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1114754456 14:25244075-25244097 AATCTACATGTCTCCAGAAAAGG - Intergenic
1115374127 14:32653977-32653999 AACCCAAATGGCCCAAGACATGG - Intronic
1115439113 14:33411476-33411498 AACAAAAATGCCTCCAGGCCGGG - Intronic
1115587472 14:34828957-34828979 AAGCAAAATGTCTACAGAGCAGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117328648 14:54691257-54691279 AGGGATAATGTCTCCAGACAAGG - Intronic
1118702069 14:68443143-68443165 AAACAAAATGTTTCCAGCCCTGG - Intronic
1119142294 14:72278259-72278281 AACCAAATTGTTTCTGGACAAGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1122390518 14:101378649-101378671 ACCCAAAAGGTATCCAGAAATGG + Intergenic
1122957150 14:105076173-105076195 AACCAAAATGTTTCCAGCATGGG - Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1125276417 15:37996773-37996795 GTCCAAAATGTCTTCAGACCTGG + Intergenic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1128471126 15:67954391-67954413 AACTCAAATGTCTCCAGGAAGGG - Intergenic
1128959301 15:71984504-71984526 AACCATTATGTCTTCAAACACGG + Intronic
1129051638 15:72786047-72786069 ACCCAAATTGCTTCCAGACATGG + Intergenic
1129888022 15:79052245-79052267 AAAGAAAGTGTCTCCAGAGAGGG - Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130159248 15:81382572-81382594 AAACAAGAAGTCTCCAGGCATGG - Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131529319 15:93178660-93178682 AGCCTAAATGTCTCCAGCCACGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132413779 15:101605929-101605951 ATCCAAAGTGTATCCAGCCATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133700751 16:8306196-8306218 TACCAAAATGTCTCTTGACTAGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134507002 16:14815849-14815871 AACGATAATATCTCCAGACCAGG - Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135060350 16:19266292-19266314 ACCCCAAATGTCTTCGGACATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135509924 16:23073562-23073584 AACTAAAATGACTGCAGTCAAGG - Intronic
1135767558 16:25190987-25191009 AACCAAAATGACTTCACACTGGG - Intergenic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1137262909 16:46845489-46845511 AACAAAAATGTGGCCAGGCACGG + Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1137893180 16:52183605-52183627 AACATAAATGTGTACAGACATGG - Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140934502 16:79658024-79658046 AACAAATATGTCCCCAAACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141188219 16:81803969-81803991 AACCAAAAAGAGTCCAGGCACGG - Intronic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142154991 16:88528855-88528877 CACCAAAATCTCTCTACACATGG + Intronic
1142869966 17:2813664-2813686 AATGAAAATGTCTCCAGGCCAGG + Intronic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1143835676 17:9690592-9690614 AACTAAAATGTTGCCAGACGTGG + Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144886945 17:18469635-18469657 AAAAAAAATGTGGCCAGACATGG - Intergenic
1145145270 17:20474659-20474681 AAAAAAAATGTGGCCAGACATGG + Intergenic
1145183923 17:20777984-20778006 AACTAAAAAGTAGCCAGACATGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147190125 17:38733598-38733620 AACCTAAAAGTCTCCAGTCTGGG + Exonic
1147342768 17:39764307-39764329 GAACAAAATGTAGCCAGACATGG + Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151062680 17:71114252-71114274 AACCAGAATGTCTGGAGACTAGG - Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1152075457 17:78156903-78156925 AAACAAAATGTGTCCAGGCACGG - Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153640857 18:7155837-7155859 AACCAACATGTCTGCACTCAGGG + Intergenic
1154054971 18:11004074-11004096 AAAGAAAATGTCTGCAGTCAGGG - Intronic
1154167569 18:12027521-12027543 AAGCAAAATGACTCCAAACTGGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159173776 18:64807968-64807990 AACCAAAAGGTTTCCATTCAAGG - Intergenic
1160288778 18:77571530-77571552 TACCACAGTGTCTCCAGGCAAGG - Intergenic
1160721056 19:597065-597087 AACCACAATGCCTCCAAGCAGGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1163576168 19:18112027-18112049 AAACAAGATGTATTCAGACAGGG + Intronic
1164035286 19:21449045-21449067 AACCAAGGTGTCTCCGGGCATGG - Intronic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1164672479 19:30080622-30080644 AACCAGAAGGTTTGCAGACAGGG + Intergenic
1164993259 19:32699717-32699739 CACCAAAATGTGTCCAGAATTGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166677739 19:44749547-44749569 AACCAAGATATCTGGAGACATGG + Intronic
1167260902 19:48457135-48457157 AAACAAAAAGTATCCAGCCATGG - Intronic
1168196333 19:54776794-54776816 AACCAAAAAGTAGCCAGGCATGG - Intronic
1168204690 19:54841049-54841071 AACCAAAAAGTATCCCGGCATGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
927262006 2:21101438-21101460 AATCAAAATGTCTCAAGACATGG - Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929615892 2:43306995-43307017 AACCAAGAGGCCTCAAGACAAGG + Intronic
930538894 2:52680124-52680146 AACCAAAATCCCTCTTGACATGG - Intergenic
931435192 2:62239879-62239901 AATCAGAAGGTCTCCAGAGAAGG + Intergenic
932764542 2:74461607-74461629 AACCAAAGGGGCTCCAGAGATGG + Exonic
935159172 2:100514395-100514417 ATCCAAAAATTATCCAGACATGG - Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937048511 2:118866865-118866887 AACCCAAATGTCCACTGACAAGG - Intergenic
937123372 2:119456409-119456431 AACGAAGATATCTTCAGACATGG + Intronic
937502348 2:122493203-122493225 TAACATAATGTTTCCAGACAAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937954237 2:127410895-127410917 AACCAAAATGTCACCAGAAAAGG - Intergenic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
938835624 2:135100898-135100920 CAGGAAAATGTTTCCAGACAAGG + Intronic
939211875 2:139185891-139185913 AAACAAAAAGGCTCCAGACTGGG - Intergenic
939614996 2:144352575-144352597 AACCTAAATGTCTCTCAACAGGG + Intergenic
940124107 2:150304652-150304674 AACTAAAAAGTCTCCAGTGATGG + Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940967380 2:159854776-159854798 AGACAAAATTTCTCCAGGCAAGG - Intronic
942380898 2:175388954-175388976 AACTAAAAAGTTTCCTGACATGG - Intergenic
942661578 2:178270532-178270554 AACCGACATGGTTCCAGACACGG + Intronic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
943181882 2:184554941-184554963 AAACAAAATGTAAACAGACAAGG - Intergenic
943417121 2:187621505-187621527 AACTAAAATGTCCCCAAATATGG - Intergenic
945052977 2:205843086-205843108 AAACAAAATGTGTGCAGGCAAGG - Intergenic
946207653 2:218121490-218121512 CACCAAAATGTGTCCAGAATTGG + Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947894146 2:233653578-233653600 AAACAAAATTTCTCAAGACTTGG - Intronic
948576301 2:238952553-238952575 AACCAAAATGTCCACTGACATGG - Intergenic
1169191061 20:3659672-3659694 AACCAAGATGCCTCCTGACAGGG + Intronic
1169385722 20:5147692-5147714 AAAAAAAATGTGGCCAGACAGGG - Intronic
1169983467 20:11413607-11413629 AACCAAAATGTCATCTAACAGGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171001611 20:21421722-21421744 AACTAAAATATCTCCAAATAGGG - Intergenic
1171219661 20:23383621-23383643 AATCAAAACGTTTCCAGATAGGG + Intronic
1171270353 20:23812265-23812287 CACCAAAATGTGTCCAGAATTGG - Intergenic
1172148286 20:32772860-32772882 AAAAAAAATGTGTCCAAACAGGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172318534 20:33976809-33976831 AACCATAATTTTTCCAGACTGGG + Intergenic
1174075549 20:47933184-47933206 TACCCAAATGTCTACCGACAGGG + Intergenic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179446391 21:41433966-41433988 AACCAAGATGTCTCTAGACCTGG - Intronic
1179599832 21:42469697-42469719 AACCAGAATATCTCCTGTCAGGG + Intergenic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1179974025 21:44853568-44853590 AAGCACAATGCCTCCAGCCAAGG + Intronic
1181288395 22:21771640-21771662 AATCAAAATGTGGCCAGGCATGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182792183 22:32962011-32962033 AACCAAAGTGTCTCAAAATATGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183811806 22:40263963-40263985 GAGCAAAATGGCTCTAGACAGGG + Intronic
1184461892 22:44642684-44642706 ATCCAAAAAGTAGCCAGACATGG + Intergenic
1184751920 22:46491168-46491190 AACCGAAACATCTCCAGACATGG + Intronic
950510462 3:13422827-13422849 ATACAAAAAGTCGCCAGACATGG + Intergenic
951846864 3:27093932-27093954 AACCCAAATGTCTCTCAACAAGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953294336 3:41698162-41698184 AACCAAAAAATCACCAAACAAGG + Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955287477 3:57656800-57656822 TACAAAAATGTAGCCAGACATGG + Intronic
955443710 3:58984681-58984703 AAACAAAATCTCTACAGAGAAGG + Intronic
955506065 3:59634433-59634455 ATTTAAAATCTCTCCAGACATGG - Intergenic
955607609 3:60722630-60722652 CAACAAAATGTCTTCAGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
955775570 3:62428812-62428834 GAAGAAAATGTCTCCAGATATGG - Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956200075 3:66696593-66696615 AACTAAAATGTGTCAAGTCAGGG + Intergenic
956566308 3:70642430-70642452 AAACAAATTTTATCCAGACATGG + Intergenic
957074264 3:75589001-75589023 AAGTAAAATGTGTCCAGAAACGG - Intergenic
958485778 3:94706095-94706117 ATACAAAATTTCTCCAGGCATGG - Intergenic
958710665 3:97713201-97713223 AAACTAAATGTCTTTAGACAGGG - Intronic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
958943145 3:100336205-100336227 AACGCAAATGTCTCCAGAAAAGG - Intronic
959706689 3:109344484-109344506 AACCAAAATTTATCCAAAAAAGG - Intergenic
959719147 3:109468179-109468201 AAACAGAGTGTCTCCAGCCAAGG - Intergenic
959780089 3:110220960-110220982 AACCAAAATATATCCAAACATGG + Intergenic
959926927 3:111932624-111932646 AAAAAAAATGACTCCAGAAATGG - Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961227510 3:125265516-125265538 AAACAAAATGTCTGCAGAACAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962857758 3:139364372-139364394 AACTAAAGAGTCTCCAGACCAGG + Intronic
962997476 3:140645337-140645359 AACCAAAATCATACCAGACATGG - Intergenic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964149127 3:153502913-153502935 AAACAAAATCTCTGCAGTCATGG + Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964515443 3:157503083-157503105 AACCGAAATGCCTGCATACATGG + Intronic
964781182 3:160340001-160340023 AGCCAAAATCTCTCCATAAAGGG + Intronic
965634880 3:170770842-170770864 ATCCCTAATGTCTCCAGACTAGG - Intronic
966469492 3:180272928-180272950 AACCAAAATCTGTTCAGAAAAGG - Intergenic
967173691 3:186843943-186843965 AACCAGAACCTCTCCAGACCAGG - Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
968243134 3:197111233-197111255 GACCAAAGGGTTTCCAGACATGG + Intronic
968515754 4:1015003-1015025 AACCAACATTTCCCCTGACAGGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970105744 4:12581297-12581319 AACCAAAATGTCCACAAATATGG - Intergenic
970872711 4:20834565-20834587 AACCAAAAGGTCCTCAGACCAGG + Intronic
970906056 4:21217768-21217790 AATCAAAGTTTCTCCAAACAGGG - Intronic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
975748556 4:77498544-77498566 AAAGTAAATGTCTCCAGAAAGGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976851398 4:89550409-89550431 AACCAAAATAAGTCCATACAAGG + Intergenic
977285539 4:95101535-95101557 CACCAAAAAGGCTCCAGAAACGG - Intronic
977854338 4:101871045-101871067 AACCAAAATATCACCAAAAAGGG + Intronic
978319161 4:107475367-107475389 AACAAAAATGTCACCAAAAATGG + Intergenic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
979350753 4:119642000-119642022 AACCAAAATGTCTACACATTTGG - Intergenic
980577322 4:134700152-134700174 AACCAAAATGTCTACTTATAAGG + Intergenic
981742017 4:148012566-148012588 AACCGAAATGTTTCTAAACAAGG - Intronic
982524402 4:156459326-156459348 AATCAGAATTTCTCCAGAGAAGG + Intergenic
983010944 4:162546354-162546376 AACCATATTGTCTGCAAACAGGG + Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984528685 4:180889058-180889080 AAACTAAATGTGGCCAGACATGG + Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
985245811 4:187978790-187978812 AAAAAAAATGTGGCCAGACACGG + Intergenic
985987936 5:3533171-3533193 GGCCAAAGTGTCTCCAGACCTGG - Intergenic
986329590 5:6707712-6707734 ATCCAAAGCGTCTCCAGACGTGG + Intergenic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987335139 5:16892333-16892355 AACCAAAATGCTTCAAGCCATGG + Intronic
988745424 5:34130778-34130800 ACCCAAAATGTATACACACAAGG + Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990366164 5:55071876-55071898 AATCAAAATGCCGCCAAACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990789361 5:59459478-59459500 AATCAAAATCTCTCCAGGCTGGG + Intronic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
992115797 5:73537635-73537657 TACCAAAATGCTTCCACACATGG - Intergenic
992918507 5:81485799-81485821 AACACAAATGTGTCCAGGCATGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
996193441 5:120573729-120573751 ACTCAAAATGTCTGCAGCCATGG + Intronic
996680063 5:126221835-126221857 CACCAAAATGTGTCCAGAATTGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
998825567 5:146097988-146098010 AAGCAAGATTTTTCCAGACAAGG + Intronic
999087217 5:148903626-148903648 CCCCAACAGGTCTCCAGACAAGG - Intergenic
1000141908 5:158413054-158413076 TACCAAAATGCTTTCAGACAGGG - Intergenic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001778331 5:174345893-174345915 AATCAAAATGTCCCCAAATAGGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003877489 6:10451373-10451395 ACCCAGAAGGTCTCCAAACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004486355 6:16069776-16069798 ATCCACAATGTTTCCAGAAATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005354000 6:24964537-24964559 AACCAAAATGTCTCCCAGTAGGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007493172 6:42240103-42240125 AACAAAGATGTTTCCACACAAGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1007940774 6:45779162-45779184 AACTAAAGTGGCACCAGACATGG - Intergenic
1008486784 6:52044987-52045009 AGCCAACATGTCTCCAAATATGG + Exonic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009292273 6:61897219-61897241 AACCACAATCTCTGGAGACAGGG + Intronic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010074653 6:71786103-71786125 CACCAAAATGTGTCCAGAATTGG - Intergenic
1010372167 6:75123141-75123163 CACCAAAATGTGCCCAGAGATGG + Intronic
1011315704 6:86028437-86028459 TACCAAGATGTCTCCAGAAATGG + Intergenic
1012296191 6:97527473-97527495 AAACAAACTGTCTCAAGAAAGGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013584245 6:111564710-111564732 AACCAAACTGTCGCCAAACTTGG - Intronic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1016218954 6:141642170-141642192 AACCTTAATGTATCCAGACAGGG - Intergenic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1016431876 6:143993597-143993619 AACTAAATTGTCTCAGGACAAGG + Intronic
1016891752 6:149014449-149014471 AACCCAAATGTCTCCAGGAGTGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020909253 7:14108282-14108304 AACCAAAGTTTTTCCAGAAATGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1021910687 7:25383347-25383369 AAGAAAAAGGTTTCCAGACAGGG - Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022438400 7:30411877-30411899 ATCTAAAATGTCTCCTTACAGGG + Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023532679 7:41174909-41174931 AACCATAAAGTCGCCAGGCATGG + Intergenic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024037497 7:45521008-45521030 AACCAAAAATTCTCCAGGCATGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1024871111 7:53962331-53962353 CACCAAAATGTGTCCAGAATTGG + Intergenic
1025758979 7:64372699-64372721 AGCCAAAAAGTCTCAACACAGGG - Intergenic
1026345747 7:69472796-69472818 AACCATATAGTGTCCAGACATGG - Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030550225 7:110949059-110949081 AGCCGAAATGTCTCAAAACAAGG - Intronic
1031515279 7:122691830-122691852 CCCCAGAATGTCTCCAGGCATGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1034732270 7:153398280-153398302 AACCACAATGGCTCCAGTCTGGG + Intergenic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1035580155 8:734870-734892 AACGAAAATGTGGCCAGGCATGG + Intronic
1036047857 8:5164135-5164157 TACCAAACTGTCTCCCAACATGG + Intergenic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036821614 8:11944195-11944217 AACCAAATTGTGGCCAGGCATGG - Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037293051 8:17371468-17371490 TACCAAAATGTTTCCATACCTGG - Intronic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1038374105 8:27020928-27020950 AACCAAAATAGATCCAAACAAGG - Intergenic
1038638458 8:29305462-29305484 CACCAAAATGTGTCCAGAATTGG - Intergenic
1039208583 8:35185176-35185198 AACTAAAATGTCTTCAGTCAAGG + Intergenic
1040358924 8:46646277-46646299 AACCAAAAAGTCTCAACACCTGG - Intergenic
1040375460 8:46820586-46820608 AACCAAAAAGTCTCAACACCGGG - Intergenic
1040379393 8:46857730-46857752 AACCAAAAAGTCTCAACACCAGG - Intergenic
1040594665 8:48825543-48825565 AACCCAAATGTCTCCCAGCAAGG - Intergenic
1040611637 8:48990267-48990289 AACCAGAATGTCACAAGCCAGGG + Intergenic
1041299415 8:56395174-56395196 AACTAAAATGGCTCCAAACCTGG + Intergenic
1043136516 8:76533495-76533517 AACCAAAATCTTGCCATACAAGG + Intergenic
1043514704 8:80985259-80985281 AACCAAAATGTCATCAGAGTCGG - Exonic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047322881 8:123804784-123804806 AACCAAAATGTCCACCAACAGGG - Intronic
1047441548 8:124883391-124883413 TACCAGAGTGTCTCCAGGCATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051054933 9:12973708-12973730 AAACAAAATGTTTTCAGACCTGG - Intergenic
1052608588 9:30738821-30738843 AGCCAAAATCTCTCCAGAGTCGG - Intergenic
1052867113 9:33470711-33470733 TACCAAAATGTATTCAGAAATGG + Intronic
1053797877 9:41742425-41742447 AGCCAAAATCTCGCGAGACATGG + Intergenic
1054186291 9:61954478-61954500 AGCCAAAATCTCGCGAGACATGG + Intergenic
1054467057 9:65503570-65503592 AGCCAAAATCTCGCGAGACATGG - Intergenic
1054652214 9:67634045-67634067 AGCCAAAATCTCGCGAGACATGG - Intergenic
1054758025 9:68978579-68978601 AACCAAAAAGTAAGCAGACATGG - Intronic
1054850194 9:69839714-69839736 AACCAAAATTTGTCCAGACATGG - Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1057936904 9:99247917-99247939 AACCACAATGACAGCAGACACGG - Intergenic
1059132985 9:111774303-111774325 AACCACTTTTTCTCCAGACAGGG + Intronic
1059233586 9:112743384-112743406 AACCGGAATGTCTCCACTCATGG + Intergenic
1059740265 9:117143272-117143294 AACCAAGAAGATTCCAGACATGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060120433 9:120984143-120984165 AACCTAAATGTCTACAGAAAGGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185486537 X:485521-485543 AACCAGGATGTCTGCAGACCAGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186682969 X:11895280-11895302 AACAAAGATGTTTCCAGGCATGG + Intergenic
1186780642 X:12908567-12908589 AACCAAAATCTCTGGATACAGGG + Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187504465 X:19867583-19867605 AGCCAAGATTTCTCAAGACAGGG + Intronic
1187927771 X:24265539-24265561 AATCTAAATGTCTTCAGAAAGGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189686908 X:43573916-43573938 GACCAAAATATCTCCAGAACAGG + Intergenic
1190782959 X:53616066-53616088 AAAAAAAATTTCTCCAGTCACGG - Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195704752 X:107730726-107730748 AAACAAAATGTCACCAATCACGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1198195947 X:134362317-134362339 AAATAAAATGTCACCAGAAAAGG - Intergenic
1198984626 X:142435067-142435089 AACCAGAATTTCTCCAGCTAAGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199749778 X:150804454-150804476 AACAAAGATCTCTCCAGGCACGG + Intronic
1199832758 X:151561751-151561773 CACCAAAATGTGTCCAGAATTGG + Intergenic
1200856687 Y:7946283-7946305 AACCAAAATGTCCCAACACTGGG + Intergenic
1200856810 Y:7947764-7947786 AACCAAAATGTATCAACACCTGG + Intergenic
1200892730 Y:8340902-8340924 AACCAAAAAGTCCCAATACATGG - Intergenic
1200902370 Y:8445653-8445675 AACCAAAAAGTCTCAACACTGGG + Intergenic
1200904241 Y:8465050-8465072 ATCCAAAATGTCTCAACACCTGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201557771 Y:15282500-15282522 AAACAAAATATAACCAGACAGGG + Intergenic
1202247788 Y:22837534-22837556 AACCAAAAAGTCTCAACACCTGG - Intergenic
1202254032 Y:22902128-22902150 AACCAAAAAGTCTCAACACTGGG + Intergenic
1202262634 Y:22985608-22985630 AACAAAAATGTCTCAACACTGGG - Intronic
1202400775 Y:24471282-24471304 AACCAAAAAGTCTCAACACCTGG - Intergenic
1202407022 Y:24535877-24535899 AACCAAAAAGTCTCAACACTGGG + Intergenic
1202415624 Y:24619349-24619371 AACAAAAATGTCTCAACACTGGG - Intronic
1202455163 Y:25050737-25050759 AACAAAAATGTCTCAACACTGGG + Intronic
1202463759 Y:25134204-25134226 AACCAAAAAGTCTCAACACTGGG - Intergenic
1202470004 Y:25198804-25198826 AACCAAAAAGTCTCAACACCTGG + Intergenic