ID: 962402225

View in Genome Browser
Species Human (GRCh38)
Location 3:135070290-135070312
Sequence GACCCACCTGGAGTGAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962402225_962402229 10 Left 962402225 3:135070290-135070312 CCAGTCTTCACTCCAGGTGGGTC 0: 1
1: 0
2: 1
3: 15
4: 100
Right 962402229 3:135070323-135070345 GGCTGCCTGCATTCCTCTGTTGG 0: 1
1: 0
2: 3
3: 106
4: 3159
962402225_962402230 11 Left 962402225 3:135070290-135070312 CCAGTCTTCACTCCAGGTGGGTC 0: 1
1: 0
2: 1
3: 15
4: 100
Right 962402230 3:135070324-135070346 GCTGCCTGCATTCCTCTGTTGGG 0: 1
1: 0
2: 1
3: 26
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962402225 Original CRISPR GACCCACCTGGAGTGAAGAC TGG (reversed) Intronic
901136779 1:7002321-7002343 GACCCACCTGCATTACAGACTGG + Intronic
901239270 1:7683560-7683582 CATCCACCTGGAGTGGGGACTGG + Intronic
901725369 1:11237801-11237823 GACCCACAGGCAGGGAAGACAGG - Intronic
902036280 1:13460609-13460631 GACCCAGCTGGGGTGAAGATGGG - Intergenic
902990104 1:20181470-20181492 GACGCACCTGGGGTTAAGTCTGG - Intergenic
903925765 1:26829392-26829414 GACATGCCTGGAGGGAAGACGGG - Intronic
904078156 1:27855325-27855347 GAGCCCCCTGTACTGAAGACAGG + Intergenic
904433022 1:30477256-30477278 GACCAACCTGGAGTGAGGCCTGG + Intergenic
915026994 1:152840419-152840441 TCCCCACCTGGTCTGAAGACAGG - Intergenic
915047582 1:153031232-153031254 GACTCACCTGGTGTGAAGAGAGG - Exonic
918191314 1:182177347-182177369 GACCCAAGTGGACTGTAGACAGG - Intergenic
921746188 1:218743139-218743161 GTCACACCTGAAGTGAAGACTGG - Intergenic
922625309 1:227034766-227034788 AAGCCAGCTGGAGTGAAGAAAGG - Exonic
922830425 1:228550536-228550558 GACACACCTGGGGTGAACTCAGG - Intergenic
924186111 1:241493162-241493184 GACCCTACTGGAGAGAAAACTGG + Intergenic
924796156 1:247293788-247293810 GGTCCACCTGGAGTGCAGGCTGG - Intergenic
1067107541 10:43376054-43376076 GTCTCACCTGGAGTGATGAGTGG - Exonic
1067450746 10:46380552-46380574 GTCCCACCTGGGGTGAGGTCAGG - Intronic
1067586497 10:47479199-47479221 GTCCCACCTGGGGTGAGGTCAGG + Intronic
1068882640 10:62066495-62066517 GGATCATCTGGAGTGAAGACAGG - Intronic
1069521496 10:69124642-69124664 GCCCCACCTGGATGGAAGAGAGG - Intronic
1072798183 10:98372650-98372672 GACCCACCTGGAGGAACCACAGG - Intergenic
1074898369 10:117796094-117796116 GACCCACTTGGAGGGAAGACAGG - Intergenic
1076649554 10:131978552-131978574 GCCCCACGTGGAGTAAACACAGG + Intronic
1076759345 10:132593260-132593282 GTCCCACCTGCACTGAGGACGGG + Intronic
1077528650 11:3084389-3084411 GACGCACCTGCAGAGAAGGCTGG - Intergenic
1088156275 11:106807721-106807743 TACCCACCTGGATTGAAGGTGGG - Intronic
1088208714 11:107427691-107427713 AGGGCACCTGGAGTGAAGACTGG + Intronic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1092013271 12:5134752-5134774 GAACCACATGTAGAGAAGACAGG - Intergenic
1092225610 12:6746356-6746378 GACTCACCTGGACTGAGGTCAGG + Intergenic
1095096459 12:38152002-38152024 GACCCCCCTGGACCGAACACAGG - Intergenic
1095979369 12:47962483-47962505 TCCCCTCCTGGACTGAAGACAGG + Intergenic
1096878496 12:54648507-54648529 GACCTACCTGCAGGGAAGGCGGG - Intergenic
1107825265 13:44323664-44323686 GACTCACCTTGAGTAAAGAGTGG - Intergenic
1116356624 14:43938643-43938665 GGCCCATCTGGAGTGATCACTGG + Intergenic
1117652514 14:57921686-57921708 GACCCACATGAAGGGAAGACAGG - Intronic
1118166875 14:63345366-63345388 GACCCACCTGTAGAGAAGGCTGG + Intergenic
1118628184 14:67677917-67677939 GGCCCTCTTGAAGTGAAGACTGG + Exonic
1120846833 14:89133644-89133666 GCCCCACCTGGAGTCAAGAAAGG - Intronic
1121093867 14:91202337-91202359 GACCCACCCAGAGGGAAGAAAGG - Intronic
1122307301 14:100773909-100773931 GATCCACCTGTAGGGCAGACAGG + Intergenic
1122672006 14:103379668-103379690 GACCCCGCTGGAGTGAAGAAGGG + Intergenic
1123921726 15:25074800-25074822 GACCCACATGGAATGATGCCAGG - Intergenic
1127647401 15:60972228-60972250 GAGCCACTTGGAGTCAAGCCTGG + Intronic
1129300951 15:74625178-74625200 GAGACAGCTGGGGTGAAGACTGG - Intronic
1135183053 16:20291840-20291862 GAGCCTCCTGGAGTGATGACAGG - Intergenic
1139563201 16:67756796-67756818 GACCCACAGTGAGTGATGACTGG - Intronic
1146469712 17:33114378-33114400 AACACACCTGGAGTGAATTCTGG + Intronic
1147424218 17:40338124-40338146 GACCCACCTAAAAGGAAGACGGG - Intronic
1148436001 17:47685824-47685846 GGCCCACCTGAAGTGAAAAATGG - Intergenic
1148436090 17:47686719-47686741 GGCCCACCTGAAGTGAAAAATGG + Intergenic
1151550609 17:74820518-74820540 GATCCACCTGGACGGAGGACAGG + Intronic
1151808845 17:76423851-76423873 GAGCCACCTGGTGTGAAGAGAGG - Intronic
1152216292 17:79034518-79034540 GACTCACCTGGAGCGAAGAGTGG - Exonic
1152770288 17:82163351-82163373 GACCCTCCTGCAGAGAAGAGTGG + Exonic
1153683046 18:7518726-7518748 AAACCAGCTGGAGTGAACACTGG + Intergenic
1160217057 18:76941303-76941325 GACCCCACTGGTGTGAAGCCAGG - Intronic
1162384265 19:10352111-10352133 CACCCAGCTGGAGTGCAGTCGGG + Intronic
1165457994 19:35925999-35926021 ACCCCAGCTGGAGGGAAGACTGG - Intergenic
929660310 2:43777739-43777761 GACTCATCTGGAGACAAGACGGG - Intronic
932740491 2:74287272-74287294 GACACACCTGCAGAGGAGACTGG - Intronic
936827458 2:116599748-116599770 GACCCAAATGGAGTGAGGGCTGG - Intergenic
939359997 2:141158954-141158976 GACGAACATGGAGTGAAAACTGG - Intronic
940296614 2:152131532-152131554 GACCCTCCTGGACTTAAGGCAGG + Intronic
944636253 2:201678629-201678651 CACCCACGTTCAGTGAAGACAGG - Intronic
945716217 2:213360509-213360531 GACACACCTGGAGAGCTGACAGG - Intronic
947523241 2:230864291-230864313 GAGCCGCCTGGAGTGGAGAAGGG - Intergenic
948005863 2:234607099-234607121 GACCCATCTGGTGGGGAGACAGG - Intergenic
1170124716 20:12950228-12950250 GACCCACATGGAGTGGAGCTGGG - Intergenic
1173176786 20:40770933-40770955 GCCCCACGTGGAGAGAAGTCAGG - Intergenic
1176199554 20:63854288-63854310 GGCACACCTGGAGTGCAGAGGGG + Intergenic
1180942066 22:19666040-19666062 CTCCCCACTGGAGTGAAGACAGG + Intergenic
1183583199 22:38737722-38737744 GACTCTCCTGGGGTGGAGACTGG + Intronic
1184761971 22:46550042-46550064 CACCCACCTGCAGTGATGAGGGG + Intergenic
949312671 3:2717499-2717521 GAAACACATGGAGTGAAGACTGG - Intronic
951625069 3:24651371-24651393 GGCCCTGCTGGAATGAAGACAGG + Intergenic
953773235 3:45794705-45794727 GGCTCACCTGGACTGATGACTGG + Intronic
954036181 3:47852467-47852489 GATCTACCTGGAGGGAAGAGTGG - Exonic
960837318 3:121919928-121919950 CACCTACCTGGAGGGAGGACAGG + Intronic
962345126 3:134613190-134613212 GAGCCACCTGGAGTCAAGGAAGG + Intronic
962402225 3:135070290-135070312 GACCCACCTGGAGTGAAGACTGG - Intronic
964056406 3:152465523-152465545 TAACCAGCTGGAGTGAAGGCTGG - Exonic
968266913 3:197369733-197369755 GACCTACCTGGAGAGGAGAGTGG - Intergenic
968299178 3:197600265-197600287 CACCCACCTGAAGTGAATAGAGG + Intergenic
968959786 4:3737657-3737679 TCCTCACTTGGAGTGAAGACAGG - Intergenic
975822197 4:78282952-78282974 GACCCACCTGATGTGCAGTCTGG - Exonic
980777472 4:137454924-137454946 GCTCCACCTGGAGTGCAGGCTGG + Intergenic
980973961 4:139593014-139593036 GACCCTCCAAGAGTGAAGATGGG - Intronic
985062166 4:186090500-186090522 GACCCAGCTGAACAGAAGACTGG - Intergenic
985870959 5:2556523-2556545 GCCCCATCTAGAGTGCAGACGGG + Intergenic
989239326 5:39186001-39186023 GGAGCACCTGGATTGAAGACTGG + Intronic
999892032 5:155988458-155988480 GACCCAGCTTGATTGAGGACAGG + Intronic
1002069709 5:176672056-176672078 GACCCACCTGGACGGCAGGCAGG + Intergenic
1003753500 6:9089600-9089622 GATCCAAATGGACTGAAGACAGG - Intergenic
1005030166 6:21501007-21501029 GACCCACCTGTAGTGTTGATGGG - Intergenic
1006935093 6:37711702-37711724 GCCCCACAGGGAGTGATGACAGG - Intergenic
1007964452 6:45990842-45990864 GACAAACCTGGATTCAAGACCGG + Intronic
1008733672 6:54515183-54515205 GAGCCACCTGGAGTGAGTAATGG - Intergenic
1008821467 6:55636875-55636897 GACCCACCTGGAGTATAGGACGG + Intergenic
1010261005 6:73816779-73816801 GACCCTCATGGAGTTAAGAGAGG + Intronic
1014067489 6:117144508-117144530 GAGCCCCCTGGAGTGAACCCAGG - Intergenic
1017656293 6:156633094-156633116 GAACCACCTGGGATGAAGATGGG - Intergenic
1018734605 6:166678231-166678253 GACCCACCTGGAGTAAGAATGGG - Intronic
1024228051 7:47343297-47343319 GACCCTTCTGGAGTTTAGACGGG + Intronic
1029380539 7:100211560-100211582 GACAGATCTGAAGTGAAGACAGG - Intronic
1032606033 7:133354721-133354743 CACACACCTGGTGGGAAGACAGG - Intronic
1032758597 7:134916073-134916095 GACAAACCTTGAGTGGAGACAGG - Intronic
1033455086 7:141495921-141495943 GACACACCTGGATTGAATATTGG - Intergenic
1035380144 7:158432845-158432867 GACTGACCTGGAGTGAAAACAGG + Intronic
1039450237 8:37667463-37667485 GACCCAGATGGAGAGAAGAATGG + Intergenic
1046486439 8:114894421-114894443 GACCCACAGGGAGGAAAGACTGG + Intergenic
1048745616 8:137611422-137611444 CACCCAACTGCAGTGGAGACTGG + Intergenic
1060894276 9:127207743-127207765 GACTCACCTGGAGGGAAGGCTGG + Intronic
1192367441 X:70485841-70485863 GACCCAGCTGAAAGGAAGACTGG + Intronic
1201384635 Y:13425395-13425417 GACCCACCTGGAGTGAACTGGGG + Intronic