ID: 962405217

View in Genome Browser
Species Human (GRCh38)
Location 3:135094523-135094545
Sequence ATTCTATTCTGAGGCAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 269}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962405204_962405217 13 Left 962405204 3:135094487-135094509 CCTCCTCCACAACTCCTCCCATG 0: 1
1: 0
2: 4
3: 53
4: 585
Right 962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 269
962405207_962405217 -1 Left 962405207 3:135094501-135094523 CCTCCCATGTCCTTCCCTTGCCA 0: 1
1: 0
2: 2
3: 89
4: 890
Right 962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 269
962405206_962405217 7 Left 962405206 3:135094493-135094515 CCACAACTCCTCCCATGTCCTTC 0: 1
1: 0
2: 1
3: 55
4: 459
Right 962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 269
962405209_962405217 -5 Left 962405209 3:135094505-135094527 CCATGTCCTTCCCTTGCCATTCT 0: 1
1: 0
2: 2
3: 78
4: 786
Right 962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 269
962405203_962405217 24 Left 962405203 3:135094476-135094498 CCTGTCGGCTGCCTCCTCCACAA 0: 1
1: 0
2: 1
3: 17
4: 156
Right 962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 269
962405205_962405217 10 Left 962405205 3:135094490-135094512 CCTCCACAACTCCTCCCATGTCC 0: 1
1: 0
2: 1
3: 35
4: 382
Right 962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 269
962405208_962405217 -4 Left 962405208 3:135094504-135094526 CCCATGTCCTTCCCTTGCCATTC 0: 1
1: 0
2: 1
3: 42
4: 379
Right 962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 23
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962405217 Original CRISPR ATTCTATTCTGAGGCAGGCA GGG Intronic
901243612 1:7710746-7710768 ATTTTATTCTCAAGCAGGGAAGG + Intronic
903118953 1:21201393-21201415 GTTCTGATCTGAGGCAGGAAAGG + Intergenic
903156664 1:21449130-21449152 ATTCTATTCAGACCCAGTCATGG - Intronic
903471812 1:23592579-23592601 AGTCTATTCTCAGCCAGGCTGGG - Intronic
903776442 1:25797073-25797095 ATGCTACTAGGAGGCAGGCAGGG + Intergenic
904162939 1:28534761-28534783 ATACTATTCTGGGCCAGGCATGG - Intronic
904280260 1:29413872-29413894 CATCTATTCTGAGCCAGGCACGG - Intergenic
904774280 1:32897111-32897133 ATACTGTTGTGAGGAAGGCAGGG - Intronic
907353608 1:53853957-53853979 ATTCCCTTCTCAGGTAGGCATGG + Intronic
907482795 1:54756143-54756165 ATGCTATGTAGAGGCAGGCAGGG + Intergenic
907852384 1:58267981-58268003 ACTAGATTCTGAGCCAGGCAGGG + Intronic
907896577 1:58698388-58698410 ATTATATTCTGGGCCAGGCATGG - Intronic
907975447 1:59427141-59427163 TTAATATTCTGAGTCAGGCAAGG + Intronic
908079723 1:60563322-60563344 CTTCCATCCTGAGGCAGGGAAGG - Intergenic
908460076 1:64340591-64340613 TTCCTATTCTTAGACAGGCATGG - Intergenic
909791265 1:79680746-79680768 AGTCTATTTTCAGGCAGCCAGGG + Intergenic
910158395 1:84246448-84246470 AGTCAATTCTGAGGAAAGCATGG - Intergenic
911881449 1:103244141-103244163 ATTTTTTTTTGAGGGAGGCAGGG + Intergenic
913992912 1:143631537-143631559 ATTCTATTCAGACCCAGTCATGG + Intergenic
914085724 1:144452480-144452502 ATTCTATTCAGACCCAGTCATGG + Intronic
914191619 1:145416461-145416483 ATTCTATTCAGACCCAGTCATGG + Intergenic
914362508 1:146947673-146947695 ATTCTATTCAGACCCAGTCATGG - Intronic
914489162 1:148139424-148139446 ATTCTATTCAGACCCAGTCATGG + Intronic
914589547 1:149094463-149094485 ATTCTATTCAGACCCAGTCATGG + Intronic
915151616 1:153837070-153837092 ATTGGATTTTGAGGGAGGCATGG - Intronic
915656955 1:157368583-157368605 ATTCCATTTGGAGGCAGGGATGG + Intergenic
917679500 1:177351393-177351415 TTTTTTTTTTGAGGCAGGCAGGG + Intergenic
918613574 1:186518938-186518960 ATTCTGTTCTGAGGCAGAACAGG + Intergenic
918994792 1:191743368-191743390 ATTTTATTCTGAAGCAAGCATGG + Intergenic
920172497 1:204080559-204080581 ATTCCATTCTGAGTCAAGCAGGG - Intronic
921650203 1:217669785-217669807 ATTTTATTTTGAGTGAGGCAAGG + Intronic
921961466 1:221039373-221039395 ATTCACATTTGAGGCAGGCATGG + Intergenic
924167226 1:241296694-241296716 ATTCTAGTCTGTGGCCTGCATGG + Intronic
1064429636 10:15259731-15259753 CATCTATTTTGAGGTAGGCATGG - Intronic
1064784988 10:18884833-18884855 ATTGTATTCTGTGCAAGGCAAGG + Intergenic
1064895702 10:20233825-20233847 ATTTTTTTTAGAGGCAGGCATGG + Intronic
1064931425 10:20632446-20632468 TTTCTATTCTGAAGAAGGCCAGG - Intergenic
1068072635 10:52215102-52215124 AGTCTATTTTGGGCCAGGCATGG + Intronic
1072172045 10:92873758-92873780 ATTGGATTCTGGGCCAGGCACGG + Intronic
1073084747 10:100880961-100880983 ATTCTGTATTGAGGCAGGAAGGG - Intergenic
1075701413 10:124471922-124471944 ATTCCATTCTGAGCTAGACACGG - Intronic
1076209613 10:128629782-128629804 TTTCTCTTCTCAGACAGGCAGGG - Intergenic
1076389120 10:130084018-130084040 ATACTATTTTGGGCCAGGCATGG + Intergenic
1079213967 11:18489388-18489410 ATAATCTTCTGAGTCAGGCATGG - Intronic
1079628576 11:22646617-22646639 AATCTATTTTGAGAAAGGCACGG + Intronic
1081167339 11:39822304-39822326 AAACTATACTGAGGCAGGAAGGG - Intergenic
1081925474 11:46823959-46823981 TATCTATTCTGAATCAGGCATGG + Intronic
1082767329 11:57180186-57180208 AATCTGTTCTGAAGCAAGCAAGG + Intergenic
1083275189 11:61593029-61593051 ATTCCATTGTGGGCCAGGCACGG - Intergenic
1086689306 11:89770567-89770589 ATTCAATTTTGGGCCAGGCACGG + Intergenic
1086716551 11:90069403-90069425 ATTCAATTTTGGGCCAGGCACGG - Intergenic
1087382684 11:97426936-97426958 TTTCTATTCTGTGGCAGGGATGG + Intergenic
1087723518 11:101693530-101693552 ACTGTACTCTGAGCCAGGCATGG - Intronic
1088263863 11:107971274-107971296 ATTGTTTTCAGAGCCAGGCATGG + Intergenic
1088399341 11:109406159-109406181 ATGCTACTCAGAGGCTGGCAGGG - Intergenic
1090463055 11:126909193-126909215 TTTCTCTTCTCAGGCAGGGAAGG + Intronic
1092988965 12:13876374-13876396 ATTCTGTTCAGAGGCAGACAAGG + Intronic
1093031316 12:14291720-14291742 ATTTTATTCTCGGCCAGGCACGG - Intergenic
1093143100 12:15533154-15533176 ATTCTATTATCAGGGAGACATGG - Intronic
1093144288 12:15545741-15545763 ATTATATTATCAGCCAGGCACGG + Intronic
1095280115 12:40341296-40341318 ATTTTCTTCTGTGCCAGGCACGG - Intronic
1095899604 12:47314221-47314243 TTTCTACCCTTAGGCAGGCATGG - Intergenic
1096363041 12:51004689-51004711 ATTCTATAGTGAGACAGTCAAGG - Intronic
1096391950 12:51236502-51236524 ACTCTATTCTGATGTAGTCAGGG - Intergenic
1097034248 12:56112242-56112264 AATCCATTTTGAGCCAGGCATGG - Intronic
1097097866 12:56564238-56564260 ATTCTTCTCTGAGCGAGGCACGG - Intronic
1098928429 12:76380408-76380430 ATTTCATTCTGAGCCAGGCATGG + Intronic
1100702584 12:97163914-97163936 ATTGTCTTCTGATTCAGGCATGG + Intergenic
1100973810 12:100100004-100100026 ATGCTATTCTCAGCCAGGCATGG + Intronic
1101422992 12:104564650-104564672 ATTCTATCCTTAGGCAGACTTGG - Intronic
1101991712 12:109490923-109490945 ACTGTATTGTGAGCCAGGCATGG - Intronic
1102133606 12:110553486-110553508 ATTGTATTTTGGGCCAGGCATGG + Intronic
1102879238 12:116471605-116471627 AGGCTATTTTGAGACAGGCAAGG - Intergenic
1103882596 12:124177626-124177648 ATTCTATTAGGAGGAAGGCCAGG - Intronic
1104093495 12:125535667-125535689 ATTCTTTTCTGAGACAGACAAGG + Intronic
1105996490 13:25677530-25677552 ATTCCCTTCTGAAGAAGGCATGG + Intronic
1108573726 13:51773527-51773549 ATTGAATTCTGAGGGAGGGAAGG - Intronic
1110192078 13:72741742-72741764 TTTCTGGTCTGAGGAAGGCAAGG + Intronic
1110243544 13:73295165-73295187 AGTATATTCTGGGCCAGGCATGG - Intergenic
1111027297 13:82546244-82546266 ATTCTATTTTTAGGCAGTTAGGG + Intergenic
1112973764 13:105291740-105291762 ATTCTCTTCTTAGGCAGGTCAGG + Intergenic
1113812469 13:113150929-113150951 TTTCTATCCTGAGACGGGCACGG - Intergenic
1115769014 14:36651357-36651379 ACTATATTCTGGGGAAGGCATGG + Intergenic
1116899578 14:50349018-50349040 ATTTTTTTCTGAGGCAGAAAAGG + Intronic
1118372084 14:65145802-65145824 ATTCTATTCTGATCCAAGCCAGG - Intergenic
1122177904 14:99934691-99934713 ATTCTATTCTGGGCCCTGCATGG + Intronic
1122661559 14:103299184-103299206 ATTCCTTTGTGGGGCAGGCAGGG - Intergenic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1127259445 15:57317548-57317570 AATCTACTCTGTGCCAGGCAGGG + Intergenic
1128478633 15:68018654-68018676 AAACTATTTTGAGCCAGGCATGG + Intergenic
1129494587 15:75966173-75966195 ATTCGATTCTGTGGCATTCAAGG + Intronic
1130356845 15:83140912-83140934 ATACTACTCTGAGGCTGCCATGG - Intronic
1131283275 15:91038118-91038140 TTTCTGTTCTGTGGCAGGCCTGG - Intergenic
1133058825 16:3161156-3161178 ATTTTTTTCTGGGGCAGTCAGGG + Intergenic
1133947534 16:10361714-10361736 ACTCTACTCTGTGCCAGGCATGG - Intronic
1135404373 16:22187668-22187690 ATAGTATTCTGAGCCAGGCATGG - Intronic
1135527469 16:23225036-23225058 AGTGTGTTCTGAGGCTGGCAGGG - Intergenic
1135842581 16:25890155-25890177 CCTCTATACTGAGGAAGGCATGG + Intronic
1137018772 16:35401617-35401639 ATTCCTCTTTGAGGCAGGCATGG + Intergenic
1137486177 16:48893330-48893352 ATTCTATCCTGATACAGGAAAGG + Intergenic
1137614852 16:49839928-49839950 ATTAGGTTCTGGGGCAGGCAGGG - Intronic
1137672224 16:50285654-50285676 GTTCCAATCTGAGGCAGGCCTGG + Intronic
1138183329 16:54957911-54957933 ATTCCATTCACAGGCATGCAGGG - Intergenic
1138539828 16:57681032-57681054 ATGCAATCCTGAGGCAGCCAGGG - Intronic
1138973427 16:62173699-62173721 ATTCCTTTCTAAGTCAGGCATGG - Intergenic
1143234042 17:5382456-5382478 ATCCTAGTCTGGGCCAGGCATGG + Intronic
1143255299 17:5553348-5553370 GTTCTGTTCTGAAGCAGGGATGG - Intronic
1144115810 17:12089200-12089222 TCTGTATTCTGAGCCAGGCAGGG - Intronic
1145012957 17:19380034-19380056 AATCTAATCTGAAGCAGGCTGGG + Intronic
1145841071 17:27995199-27995221 ATTCCATTTTGAGGAAGGAAGGG - Intergenic
1146533966 17:33633747-33633769 GTCCTATTCTAAGGCAGGAAAGG + Intronic
1149003767 17:51783564-51783586 TCCCTATACTGAGGCAGGCAAGG + Intronic
1150856985 17:68762762-68762784 TTTACATTCTGGGGCAGGCATGG - Intergenic
1150933236 17:69608048-69608070 ATTATATTCTGACTTAGGCATGG - Intergenic
1151863204 17:76781654-76781676 ATTTTAATCTGAGGAAGCCATGG + Intergenic
1152030744 17:77841299-77841321 ATTCTAATCTGGGCCAGGCACGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1152607822 17:81301886-81301908 ATTCTTTCCTGAAGCAGGCCAGG - Intergenic
1155382693 18:25241439-25241461 ATTCTATTATGAGGAATGCATGG - Intronic
1157017168 18:43729551-43729573 TTTCTAATCTGAGGCAGGGGAGG - Intergenic
1158143388 18:54281593-54281615 ATACTATACTAAGGAAGGCAAGG - Intronic
1159471375 18:68860828-68860850 ATTCTATTTTGAGGTGGGAAAGG - Intronic
1163127240 19:15250956-15250978 ATTCTGTATTGAGACAGGCAGGG - Intronic
1163410474 19:17150737-17150759 CTTCCATACTGGGGCAGGCACGG - Intronic
1164164255 19:22654889-22654911 ATACAATTCTCAGTCAGGCACGG - Intronic
1164396578 19:27869492-27869514 ATTCTATGCTTAGGCAGCCTGGG - Intergenic
1164570329 19:29370011-29370033 ATAGCATTCTGAGCCAGGCATGG + Intergenic
1165202285 19:34154911-34154933 ATTCTATCCCCAGTCAGGCACGG - Intergenic
1165486652 19:36100708-36100730 CAGCCATTCTGAGGCAGGCATGG - Intronic
1166198666 19:41222348-41222370 ATTCTATTCAGAGAGAGGCCGGG - Intronic
925481636 2:4281930-4281952 AGTTAATTCAGAGGCAGGCATGG + Intergenic
925753101 2:7107600-7107622 ACTCCATTCTGAAGCAGCCAAGG + Intergenic
926306636 2:11641774-11641796 AAACCATTCTGGGGCAGGCACGG - Exonic
928208441 2:29304810-29304832 ATCCCCTTTTGAGGCAGGCAGGG - Intronic
928400855 2:30977747-30977769 ATTCTGGTCTGAAGCAGGGAGGG + Intronic
928402620 2:30990290-30990312 GTTCAGTTCTGAGGCAGACAGGG + Intronic
929545342 2:42851861-42851883 GTTTTATTTTGAGGGAGGCAAGG + Intergenic
930367783 2:50462905-50462927 ATTCTATTTTGGGGGAGGGAAGG + Intronic
930522541 2:52485688-52485710 ATTCTACTGTGATACAGGCAGGG + Intergenic
931330352 2:61274984-61275006 ATAATATTCTGGGCCAGGCATGG + Intronic
933230495 2:79801699-79801721 AAGCTATTCTGGGCCAGGCATGG + Intronic
935076460 2:99749575-99749597 ATTTTATTCTAAGGATGGCAGGG + Intronic
935300649 2:101691252-101691274 ATACTATTCTGGGCCAGGCGCGG + Intergenic
937310533 2:120900081-120900103 TTTGAGTTCTGAGGCAGGCAAGG + Intronic
937408743 2:121654233-121654255 ATTCCATTTTGGGCCAGGCAGGG + Intergenic
937735553 2:125283518-125283540 ATTCTATTATGACTCAGGCATGG - Intergenic
938324641 2:130390466-130390488 ATTCCCATCTGAGGCTGGCACGG - Intergenic
938749024 2:134311025-134311047 ATTCTATTTTGTGTCAGACAAGG - Intronic
939799040 2:146684113-146684135 ATTCTATACTCGGCCAGGCACGG + Intergenic
940495064 2:154417130-154417152 ATTCAAGTCTGAGGCAATCAAGG - Intronic
940953484 2:159703591-159703613 ATTCAATTTTGGGCCAGGCATGG + Intergenic
943608083 2:189999815-189999837 TTACTATTCAGAGCCAGGCATGG + Intronic
945277142 2:207999322-207999344 ATCCTTTTCTTAGCCAGGCATGG + Intronic
946561706 2:220921406-220921428 ATTCATTTAGGAGGCAGGCATGG - Intergenic
1168749524 20:272644-272666 AGTTTATTTGGAGGCAGGCATGG - Intronic
1168829307 20:835865-835887 AATCTCCTCTGGGGCAGGCAAGG + Intronic
1170939505 20:20836760-20836782 AATCTATTCTGAGACAAACAGGG - Intergenic
1171474197 20:25395134-25395156 ATTTTATTCTGAAGTAGCCACGG + Intergenic
1171968519 20:31548881-31548903 ATACTAATCTGGGGCAGCCAAGG + Intronic
1173245170 20:41332062-41332084 AAAATATTCTGAGCCAGGCACGG - Intergenic
1174696586 20:52565638-52565660 ATTCGCTTCTCAGGCAGGTAGGG - Intergenic
1175384153 20:58583581-58583603 ATCCTTTTTTGAAGCAGGCAGGG + Intergenic
1177444284 21:21171590-21171612 ATTCCAGTCTGTGGCAGTCAAGG - Intronic
1180065768 21:45411470-45411492 CTTCTCTTCTCGGGCAGGCACGG - Intronic
1180674252 22:17576411-17576433 ATTCAATTCTGTGGAGGGCAAGG + Intronic
1181354082 22:22288293-22288315 ATACTATTTTTAGCCAGGCATGG - Intergenic
1181498240 22:23300463-23300485 TTTCCAGTCTGAGGCTGGCATGG + Intronic
1181620813 22:24090010-24090032 ATTCTGCTCTGAGGATGGCAAGG + Intronic
1181991002 22:26836695-26836717 TTTCTACTCTGAGCCAGGCATGG - Intergenic
949633518 3:5956478-5956500 ATTCTATTCTGATTCAGTCTTGG - Intergenic
955391579 3:58526102-58526124 ATTCTATGCTGTGGCCTGCAAGG - Intronic
955689830 3:61580153-61580175 GTTGTACTCTGAGCCAGGCACGG + Intronic
958004173 3:87792073-87792095 ATTTTATTCTCAGGCATGCCTGG - Intergenic
958482179 3:94656860-94656882 ATTCTTTTTTGGGACAGGCAGGG + Intergenic
959173429 3:102872663-102872685 GTTCCTTTCAGAGGCAGGCATGG + Intergenic
960930842 3:122847633-122847655 ATTGTATACTGGGCCAGGCATGG - Intronic
962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG + Intronic
962840595 3:139229056-139229078 ATTCAATGATGAGGGAGGCAGGG + Intronic
964172623 3:153789173-153789195 ACTCTATTTAGAGCCAGGCACGG - Intergenic
968338267 3:197932342-197932364 ATTCTATTTTCAGCCGGGCATGG + Intronic
969792137 4:9499291-9499313 GAGCTATGCTGAGGCAGGCATGG - Intergenic
970155408 4:13136736-13136758 ATTCTACTCTGTGTCAGGCATGG - Intergenic
970314401 4:14815518-14815540 ATACTTCTCTGTGGCAGGCAGGG - Intergenic
971562877 4:28103942-28103964 ATCCTATTCTTGGCCAGGCACGG + Intergenic
972521128 4:39857958-39857980 ATTTTATTCTTGGCCAGGCATGG - Intronic
974802134 4:66831357-66831379 AATCTATTCTTGGCCAGGCATGG + Intergenic
974831312 4:67193040-67193062 ATCCTATTTGGAGGGAGGCATGG - Intergenic
976941363 4:90705767-90705789 ATTATATTCTGAGCCTGGCTCGG - Intronic
978581612 4:110237206-110237228 AATCTATTCTGTTGAAGGCAGGG - Intergenic
979880578 4:125953303-125953325 ATTATATTCTGTGGTAAGCAGGG + Intergenic
981059702 4:140409717-140409739 ATTTTATTGTGAGGCAGGGTGGG + Intronic
981320907 4:143390129-143390151 ATTCTATTCTGTTGCACACAAGG - Intronic
982038866 4:151375082-151375104 ATTCTAGTCTGGGGCAGGAAAGG - Intergenic
982342548 4:154317424-154317446 GTTTCATTCTGAGGCATGCATGG - Intronic
982472698 4:155812524-155812546 ATTACAGTCTAAGGCAGGCATGG + Intergenic
983343052 4:166490761-166490783 ATTCTATTCTAAGGCAACCCAGG + Intergenic
983587833 4:169375153-169375175 ATTCTACTCCAGGGCAGGCAGGG - Intergenic
983647338 4:170005068-170005090 TTTCTAGGCTGAGGCAGGGAGGG - Intronic
985403039 4:189611095-189611117 CTTCTTTTATGTGGCAGGCAGGG - Intergenic
985587858 5:750261-750283 CTTGCAGTCTGAGGCAGGCAGGG + Intronic
985602525 5:842728-842750 CTTGCAGTCTGAGGCAGGCAGGG + Intronic
987663018 5:20902078-20902100 AGTCTACTCTGAGGGAGGGAGGG + Intergenic
988806982 5:34749557-34749579 ATTCTAGATGGAGGCAGGCAAGG + Intronic
990327848 5:54695838-54695860 CTTCTACTCTGTGCCAGGCAGGG + Intergenic
990479656 5:56197296-56197318 ATTTTATATTGAGGCAGGAAGGG + Intronic
992888310 5:81181048-81181070 GTTCTGCTCTGAGCCAGGCAGGG - Intronic
994305819 5:98202824-98202846 AATCTATTCTGAGGAAGTCTTGG - Intergenic
995042959 5:107609799-107609821 ATTCTAGTCGGCGGCGGGCAGGG - Intronic
995282929 5:110355809-110355831 TTACGTTTCTGAGGCAGGCAAGG + Intronic
995730230 5:115231402-115231424 AGTCTATTCTGAGGCAGTCTGGG + Intronic
996916072 5:128713666-128713688 ACGTTTTTCTGAGGCAGGCAGGG + Intronic
997386540 5:133477628-133477650 ATTCTCTTCTCAGGAAGACACGG + Intronic
997476067 5:134143241-134143263 GTCCTCTTCTGAGGCAGCCATGG - Intronic
997510353 5:134449672-134449694 ATCCTATTCTAAGGAGGGCAGGG - Intergenic
998911723 5:146967360-146967382 ATTTTATTATGTGCCAGGCAGGG + Intronic
999068676 5:148718849-148718871 TTTCTATTCTGAAGGAGGAAGGG - Intergenic
999990238 5:157043372-157043394 AGTATATTCTCAGCCAGGCATGG + Intronic
1000518801 5:162274490-162274512 ATTCTATTATTAGTCAGGTATGG + Intergenic
1002289623 5:178190996-178191018 ATTCTGTTTTGAGCCAGGCACGG + Intergenic
1003325463 6:5086828-5086850 TTCCTATTCTGACGCAGGCTGGG - Exonic
1004080270 6:12385837-12385859 ATTCTATTCTGAGCTAAGTAAGG - Intergenic
1004270171 6:14188219-14188241 ATTCCATTCTTAGCCAGGCATGG - Intergenic
1004481021 6:16019378-16019400 CTTCTTTTCTCAGGCAGGAATGG - Intergenic
1005231400 6:23705525-23705547 ATTCTATTCTGAAGCAAGTGTGG + Intergenic
1006075949 6:31532591-31532613 TTTCTATTCTATGGCTGGCACGG - Intronic
1008105728 6:47439262-47439284 AGTCTATTAGGAGACAGGCATGG + Intergenic
1010464517 6:76151275-76151297 CATCTCTTCTGAGGCAGGGACGG + Intergenic
1013035467 6:106378313-106378335 ATTCTGTTCTGAAGCTGGTACGG + Intergenic
1015304765 6:131695623-131695645 AATCTAATCTGGGCCAGGCACGG + Intronic
1016099847 6:140085594-140085616 ATTTTTTTCTGAGTGAGGCAAGG + Intergenic
1017032634 6:150237491-150237513 ATGCTACTCTGGGCCAGGCATGG - Intronic
1018763868 6:166914252-166914274 ATGCTATTCTGAGACTGGAAAGG - Intronic
1019683980 7:2370065-2370087 ATAATATTCTCAGCCAGGCACGG - Intronic
1020353248 7:7246995-7247017 ATTTTATATTGAGGCAGGAAGGG + Exonic
1020641975 7:10766809-10766831 ATTATTTTCTGGGCCAGGCATGG - Intergenic
1021361553 7:19719225-19719247 ATGCTATTCTGAGAGTGGCAAGG - Intergenic
1022454541 7:30546905-30546927 ATTCTGGTCTGAGAGAGGCATGG - Intronic
1023395707 7:39749938-39749960 AGGCTATTCTGATGCAGGCAAGG + Intergenic
1025104264 7:56157911-56157933 ATTCCCTCCTGAGGTAGGCAGGG - Intergenic
1026159800 7:67858836-67858858 ATGCTAGGCTAAGGCAGGCAAGG + Intergenic
1026274303 7:68863394-68863416 ATTCAATTCTGAACCAGGCAAGG - Intergenic
1030296060 7:107928781-107928803 CTTCTATTCTTGGGCGGGCATGG - Intronic
1030768644 7:113443859-113443881 TTTATATTCTGAGGCATACAAGG - Intergenic
1031562075 7:123250751-123250773 AGTCTATCCTGGGCCAGGCATGG + Intergenic
1031693359 7:124817976-124817998 AATCTATTCTCAGCCGGGCATGG - Intergenic
1032640804 7:133765284-133765306 ATTCAATCCAAAGGCAGGCAGGG - Intronic
1033139153 7:138809416-138809438 CTGCCATTCTGAGTCAGGCAGGG - Intronic
1034591534 7:152144141-152144163 ATTCCATTCTGAGACATCCAAGG + Intronic
1034911281 7:155001057-155001079 CATCTAATATGAGGCAGGCATGG - Intronic
1035077623 7:156191403-156191425 ATTTTATGCTGCAGCAGGCATGG + Intergenic
1038052426 8:23826498-23826520 ATTCTGTTCTTAGGAAGGGAAGG + Intergenic
1039011515 8:33098755-33098777 ATGCTATTTTGGGCCAGGCACGG + Intergenic
1039070386 8:33644277-33644299 ATTGTATTATAAGCCAGGCATGG + Intergenic
1039625597 8:39048516-39048538 ATACTATTCTCAGGCACACATGG - Intronic
1040584255 8:48725511-48725533 ATTCTAATGGGAGCCAGGCATGG + Intronic
1041675410 8:60533678-60533700 ATACTATTGTGGGCCAGGCATGG + Intronic
1042522418 8:69727615-69727637 CTTCCACTCTGAGCCAGGCATGG - Intronic
1042915464 8:73870995-73871017 ATTATATTCTGAGGAAGAGAGGG + Intronic
1044232966 8:89800436-89800458 ACTAGATTCTGAGTCAGGCATGG + Intergenic
1044541397 8:93412222-93412244 ATTCTATTTTGAGGTGGGAAAGG - Intergenic
1044657621 8:94564914-94564936 ATTCTATTTTTTGCCAGGCACGG - Intergenic
1044701908 8:94972919-94972941 ATTCAATTCTTAGCCAGGTATGG + Intronic
1045362131 8:101442547-101442569 ATTCTCTTCTGGGGCAGGACAGG - Intergenic
1050124449 9:2342265-2342287 ATTCTCTGCTGAAGAAGGCATGG - Intergenic
1050622110 9:7464928-7464950 ATTCTTTTCTGAGGTAGTCTGGG - Intergenic
1050657263 9:7842534-7842556 AACCTATTCTGAAGCTGGCAGGG + Intronic
1053058845 9:35012607-35012629 AATTTAGTCTGAGCCAGGCATGG + Intergenic
1053248364 9:36553903-36553925 ATATTATTCTGGGCCAGGCATGG - Intergenic
1053506095 9:38644766-38644788 ATAATGTTCTGAGTCAGGCATGG + Intergenic
1056134288 9:83616006-83616028 ATTTTATTATAAGCCAGGCATGG - Intergenic
1057800639 9:98189301-98189323 AATCTGTTCTGAAGGAGGCAAGG + Intronic
1058206003 9:102108743-102108765 ATTTTATGCTGAGGCAAACAGGG + Intergenic
1058890025 9:109353693-109353715 AATCTATACTGTGCCAGGCATGG - Intergenic
1185727201 X:2431522-2431544 ATTCAATTCTTAGGAAGACATGG + Intronic
1185770187 X:2759993-2760015 ATTCTGGTCTGATCCAGGCATGG + Intronic
1186160426 X:6771554-6771576 AATCTATTATGTGGAAGGCAAGG - Intergenic
1187932439 X:24305878-24305900 ATGTTATTTTGAGGCCGGCATGG + Intergenic
1188026462 X:25215363-25215385 ATGCTATTCTGGGCCAGGCGTGG + Intergenic
1188582927 X:31737365-31737387 ATTATATTCTGAATCAGTCATGG + Intronic
1189972960 X:46436465-46436487 ATGCTACACTTAGGCAGGCATGG + Intergenic
1190219844 X:48504791-48504813 ATTCTTTTCTGGGCCAGGCGCGG - Intergenic
1190824043 X:54000696-54000718 ATTCTATTCTGGATCAGACAAGG + Intronic
1191666101 X:63704423-63704445 ATTCTGTTCTGTGCCAGGCCTGG - Intronic
1192198331 X:69047253-69047275 AGGCAATTCTGAGGCAGGGAGGG + Intergenic
1192564421 X:72151765-72151787 ATACTAGTATGAGGCAGGAAAGG - Intergenic
1195683448 X:107565401-107565423 ATTATATTCACAGGCCGGCATGG + Intronic
1196283820 X:113856463-113856485 ACTCTATTCTGAGGCTGGGATGG - Intergenic
1197279948 X:124523548-124523570 GTTCTCTTCTCAGGCAGGAAAGG + Exonic
1198727205 X:139690903-139690925 ACTCTGTTCTGAGGCAGCCCCGG + Intronic
1199067163 X:143433074-143433096 ATGCTATTGTGAGGATGGCAGGG - Intergenic
1199652547 X:149960832-149960854 AGTCTCTTCTGAGGTAGGGATGG - Intergenic
1200079398 X:153568402-153568424 ATGCAAATCTGAGGCAGGAAAGG + Intronic
1200863784 Y:8020879-8020901 AATCCACTCTGAGGCATGCATGG + Intergenic