ID: 962405422

View in Genome Browser
Species Human (GRCh38)
Location 3:135095891-135095913
Sequence TTCCCAAGGCTCTCCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962405419_962405422 27 Left 962405419 3:135095841-135095863 CCTGTTATAGGGGGCTTATATCT 0: 1
1: 0
2: 0
3: 2
4: 52
Right 962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG 0: 1
1: 0
2: 0
3: 24
4: 188
962405420_962405422 -4 Left 962405420 3:135095872-135095894 CCTTCACTTAGATGTCGCTTTCC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG 0: 1
1: 0
2: 0
3: 24
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962405422 Original CRISPR TTCCCAAGGCTCTCCCAGAG TGG Intronic
900626965 1:3612738-3612760 TTCCCAAGCCCCTCCCAGCCAGG - Intergenic
901684357 1:10935330-10935352 TTACCAAGGACCTCCCAGGGAGG - Intergenic
902527536 1:17068929-17068951 GTCCCAAAGGTCTCCCAGCGGGG + Exonic
902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG + Intergenic
903175289 1:21576682-21576704 TTCCCAAGCCCATCCCCGAGGGG - Intronic
903181319 1:21606296-21606318 TTTCCAGGGCTTACCCAGAGTGG - Intronic
903329200 1:22588570-22588592 ATCCCACTGCTCACCCAGAGTGG - Intronic
904261233 1:29288932-29288954 TGCCCCAGGTGCTCCCAGAGGGG + Intronic
904474729 1:30757526-30757548 TTGCCCAGGGTCCCCCAGAGAGG + Intronic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
906178341 1:43796001-43796023 CTCCCAAGGCTCAGACAGAGGGG + Intronic
908279062 1:62510644-62510666 TTCCAAAGGCACTTCCAGATGGG + Exonic
909968288 1:81946445-81946467 TTCCTAAGGCCATTCCAGAGAGG - Intronic
912475753 1:109933782-109933804 TGCCCAGGGCTTGCCCAGAGGGG - Intergenic
913267455 1:117059432-117059454 TTCTCTAGGCTCGCCCAGCGTGG - Intergenic
919258551 1:195158296-195158318 TTCCCAAGGCTCCACCTCAGTGG + Intergenic
919767122 1:201134647-201134669 TTCCCAAGGCTCTGCCTGTCTGG + Intergenic
919829605 1:201531324-201531346 GTATCCAGGCTCTCCCAGAGCGG + Intergenic
922233167 1:223703563-223703585 TGGCCAAGGCTTTCTCAGAGTGG + Intronic
922280135 1:224114989-224115011 TTCCCAAGGCTCTACTTTAGTGG - Intronic
923051488 1:230393894-230393916 TTCGCAAGGCTCTCCCTCACTGG + Intronic
924604378 1:245520320-245520342 TTCCCAAGCCTCTGGGAGAGGGG - Intronic
1064632440 10:17330345-17330367 TTTCCAAGGCTTTCCCTGATAGG + Intronic
1064960157 10:20954749-20954771 TTCCCAAGGCTCTACCCTAGTGG + Intronic
1066209146 10:33219663-33219685 TTCACAAGGATTTCCCTGAGAGG - Intronic
1067481078 10:46598006-46598028 TCCCCACGGCTCTCCTAGCGGGG - Intergenic
1067613674 10:47743816-47743838 TCCCCACGGCTCTCCTAGCGGGG + Intergenic
1067929108 10:50541700-50541722 TTCCCAAACATCTCCCAGAGTGG - Intronic
1069103551 10:64354893-64354915 CACCCAAGGGCCTCCCAGAGTGG - Intergenic
1069143809 10:64863123-64863145 ATCCCAGGGCTCTCCTTGAGAGG + Intergenic
1069316032 10:67103606-67103628 TTGCCAAGGCTCACACAGTGGGG + Intronic
1072792348 10:98327385-98327407 CTCCCAAAGCTCTCCCAGGATGG - Intergenic
1073830456 10:107377551-107377573 TCCTCAAGGATGTCCCAGAGAGG + Intergenic
1077310444 11:1886596-1886618 TTCCCAATGCAGCCCCAGAGTGG - Intronic
1078428507 11:11269893-11269915 GTCCTGAGGCTGTCCCAGAGGGG + Intergenic
1078519867 11:12054080-12054102 TTCACAGGGCACACCCAGAGGGG - Intergenic
1078867626 11:15312589-15312611 TGCCCATGGCTCTCCCAGGCTGG - Intergenic
1080796811 11:35571899-35571921 TTCCCAAGTTTCCCCCAGGGAGG + Intergenic
1085051352 11:73381812-73381834 CACCCAGGGCCCTCCCAGAGAGG + Intronic
1086119866 11:83294532-83294554 TTCCCTAGTCTTTCCCAGTGAGG - Intergenic
1086899233 11:92347555-92347577 GAGCCAAGGCTGTCCCAGAGAGG + Intergenic
1087507790 11:99049023-99049045 TTCCCAATTCTCTCCCAGGAAGG - Intronic
1090076205 11:123581448-123581470 TCCCAAAGGCTCTGCCAGACGGG - Intronic
1090432236 11:126655659-126655681 TTCATAAGCCTCTCCCAGGGTGG - Intronic
1092564468 12:9649677-9649699 TTCCCAAGGCTCCACCTCAGTGG + Intergenic
1092587354 12:9912791-9912813 TTCCCAAGGCTCCACCTCAGTGG + Intronic
1093978693 12:25452229-25452251 TGCACACGGCTCTCACAGAGAGG + Intronic
1094693070 12:32788643-32788665 TTCACAGGGGACTCCCAGAGAGG + Intergenic
1098029640 12:66240646-66240668 TGCCTCAGGCTGTCCCAGAGGGG + Intronic
1099339368 12:81409191-81409213 TTCCCTAGGCTCTCACTGAGAGG + Intronic
1100092660 12:90990392-90990414 TTACAAAGGATATCCCAGAGAGG + Intronic
1100270532 12:93020297-93020319 TTCCCTAGTCCCTCCCAGACAGG - Intergenic
1101950885 12:109174124-109174146 TTCCTCAGGCCCTCCCAGTGAGG + Exonic
1102522727 12:113488735-113488757 ACCCCAAGGCTTTCCCACAGAGG + Intergenic
1104044686 12:125153510-125153532 ATCCCCAGGCTCTGCCAGAAGGG + Intergenic
1104982518 12:132580507-132580529 TTCCTCAGCCTCTCCCAGTGCGG + Intronic
1106410987 13:29511402-29511424 TTCCCCAGGCTGTCTCAGAAAGG - Exonic
1106994852 13:35469936-35469958 ATCCAAAGGCTCCCCCAAAGGGG + Intronic
1109526848 13:63586716-63586738 TTCCCAAGGCTCCACCCCAGTGG + Intergenic
1110470486 13:75854467-75854489 CTCCCTCTGCTCTCCCAGAGTGG - Intronic
1111621107 13:90727079-90727101 TTTTCAAGGCTGTCCCTGAGTGG - Intergenic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1113083432 13:106541163-106541185 TTCACAAGGCTCTCCTGGAGGGG + Intergenic
1113625393 13:111792322-111792344 TTCCCAGGTCTCTCTCATAGGGG + Intergenic
1114449888 14:22818539-22818561 ACCCCTAGGCTCTCCCAAAGGGG + Intronic
1115641626 14:35339033-35339055 GTCCCAAGGCCCTCGCTGAGGGG - Intergenic
1116786455 14:49293970-49293992 TTCTCAAGTCTCCTCCAGAGGGG - Intergenic
1116867016 14:50039595-50039617 TTTCCAGGACTCTCCCTGAGAGG + Intergenic
1118832061 14:69443288-69443310 GTCACAAGGCTCTCCCATTGGGG - Intronic
1118889153 14:69893412-69893434 TTCTCAAGGCTCTGTCAGTGGGG + Intronic
1119162053 14:72460821-72460843 ATCCCATGGGTCTCCCAGACAGG - Intronic
1121000542 14:90449290-90449312 CTCCCAAAGCTATGCCAGAGAGG + Intergenic
1121051648 14:90822765-90822787 TACCCAGGGCCCTCCCTGAGCGG - Intergenic
1122182620 14:99967109-99967131 TTCCCGAGGCTCCCCCTCAGTGG - Intergenic
1122327183 14:100889817-100889839 CGCCCAAAGCCCTCCCAGAGAGG - Intergenic
1123849711 15:24342537-24342559 TGCCCCAGGGGCTCCCAGAGGGG + Intergenic
1124236038 15:27990112-27990134 TTCCCATGTCCCTGCCAGAGAGG + Intronic
1124909333 15:33903405-33903427 GTCCCTGGGCGCTCCCAGAGAGG + Intronic
1128697792 15:69781446-69781468 CTTCCCAGGCTCTCCCATAGAGG + Intergenic
1129682149 15:77663961-77663983 TGCCCCAGCCTCTGCCAGAGGGG - Intronic
1129970127 15:79770953-79770975 CCCCCGAGGCTCTACCAGAGAGG - Intergenic
1130348821 15:83072334-83072356 TTGCCAAGGCTCTCCCATCCTGG - Intergenic
1131550290 15:93351250-93351272 TTCCCAAGGGTTTCAAAGAGTGG + Intergenic
1133264600 16:4575665-4575687 TCCCCAAGGCTGGCCCAGGGTGG + Exonic
1133770747 16:8866260-8866282 TTTCTAAGGCGCTCCCAGTGAGG + Intronic
1138997291 16:62471693-62471715 TTCTCAATGCTCTCAAAGAGTGG + Intergenic
1139713023 16:68790908-68790930 TTTCCAGGCCTCTCCCAGAGAGG - Intronic
1143622226 17:8087304-8087326 TTGCAAAGTCTCTCCCAAAGTGG + Exonic
1144129220 17:12229621-12229643 CTCACAAGGCTCTCCAAGAGGGG + Intergenic
1144369785 17:14579137-14579159 TTCACAAGGCCCTTCCAGAATGG + Intergenic
1146158799 17:30547953-30547975 TGCCTGAGGCTCTCCCAGGGTGG + Intergenic
1148470252 17:47888838-47888860 TTCCCGAGTCTCTCCCAGCCAGG + Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1155593458 18:27454481-27454503 TTCCCAAGGCTCCACCTCAGTGG + Intergenic
1158453695 18:57588416-57588438 TTCTCCAGGGCCTCCCAGAGGGG - Intergenic
1159134915 18:64326397-64326419 TTCCCAGGGCTCTACCCCAGTGG + Intergenic
1160924211 19:1535313-1535335 TTCCTGTGGCTCCCCCAGAGGGG + Exonic
1161977366 19:7613831-7613853 TTCCCATGGCTTTCCCAGCCGGG + Intronic
1162520358 19:11175908-11175930 ATCCCAACGCCCTCACAGAGCGG - Exonic
1165143998 19:33719989-33720011 GTGCCGAAGCTCTCCCAGAGGGG - Intronic
925147005 2:1588400-1588422 TCCCCAAAGCTCTCCAAGAGGGG + Intergenic
926893614 2:17660238-17660260 TTCCCAAGGCTGGGCCAGAAAGG - Intergenic
930776980 2:55182798-55182820 TTGAAAAGGCTCTCTCAGAGAGG + Intronic
930980878 2:57524396-57524418 TTCCCGAGGCTCTACCCCAGTGG - Intergenic
931668112 2:64624649-64624671 TTCTCAAGGCTGGCCCAGAGGGG - Intergenic
937792785 2:125980083-125980105 TTCCCAAGGGAATCCCAGAAAGG + Intergenic
942198636 2:173548662-173548684 TTCCCAAGGCATTCCCAAAAGGG + Intergenic
946125320 2:217557624-217557646 TGGGCAAGGCTCTCCTAGAGAGG + Intronic
946625021 2:221602176-221602198 TTCCTAAGACCCTCCCACAGAGG + Intergenic
1168826206 20:816060-816082 CTCCCAGGGCTCGCACAGAGAGG + Intergenic
1168910212 20:1441193-1441215 TTCCAAAGTGTCTTCCAGAGGGG - Intergenic
1170588036 20:17750341-17750363 TTCCCAGGGCTCACACAGGGTGG + Intergenic
1170620344 20:17990495-17990517 TCCCCAGGGTTCACCCAGAGGGG + Exonic
1170645117 20:18190953-18190975 TCCCCAAGGCTTAGCCAGAGCGG - Intergenic
1170829712 20:19829711-19829733 TTCCCAAGTGACTCCCAGAATGG + Intergenic
1171785301 20:29458472-29458494 ATCCCAAGGGCCTCGCAGAGGGG + Intergenic
1172138921 20:32708075-32708097 TTCACAAGTCACTTCCAGAGGGG + Intronic
1173849226 20:46207397-46207419 TTCTGCAGGCTCTCCCAGGGAGG - Intronic
1176136082 20:63522573-63522595 CTCCCAAGGGCCTCCCATAGGGG + Intergenic
1178885531 21:36482004-36482026 CTCCCAATCCTCTCCCTGAGTGG + Intronic
1182530844 22:30955356-30955378 TTCAAAAGGCTCTGCCAAAGTGG - Intronic
1183457196 22:37929349-37929371 TCCCCAAGGCGCTCCCAGCCAGG + Intronic
950523983 3:13513043-13513065 CCCCCAAGGCTCTCCCAGCCAGG + Intergenic
950670306 3:14521840-14521862 TTCCCAGCGCCCTCCCAGACAGG - Intronic
951186804 3:19723004-19723026 TGTCCAAGGATTTCCCAGAGTGG + Intergenic
951799152 3:26575821-26575843 TTCCTAAGACTCTACCAGAGTGG - Intergenic
952710528 3:36427377-36427399 TTTCCAAGGCTGGCCCAGAGGGG - Intronic
957952148 3:87141153-87141175 TTCCCAAGGCTCCACCTCAGTGG - Intergenic
960590840 3:119363946-119363968 TTCACAACCCTCTCACAGAGGGG + Intronic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
966111521 3:176408433-176408455 ATACCCAGACTCTCCCAGAGAGG + Intergenic
970438421 4:16058060-16058082 TTCCAAGGGCTCTCACAAAGAGG + Intronic
971191793 4:24435505-24435527 TCCCCAAGGCTCTCACAGATTGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972268212 4:37483238-37483260 TTCCCAAGGCCTTCCCAGACAGG + Intronic
972559581 4:40214884-40214906 TTCCAATGGCTCTCCCCGTGGGG + Intronic
973714531 4:53662299-53662321 ATCCCAAGCCTCTTCCAGAAAGG - Intronic
973807182 4:54537877-54537899 TGACCAAGGACCTCCCAGAGAGG + Intergenic
973868763 4:55143080-55143102 TTCCCAAGTGTCCCCCAGAAGGG + Intergenic
976227135 4:82804057-82804079 TTCCCCACTCTCTTCCAGAGTGG - Intergenic
976359547 4:84161429-84161451 CTCCCCAGGTTCACCCAGAGAGG + Intergenic
978570098 4:110127470-110127492 TTTCTTAGGCTCTCCCATAGAGG - Intronic
983321122 4:166198209-166198231 TTCCCAAGGCTCCACCCCAGTGG - Intergenic
984222355 4:176993875-176993897 TTTCCAAGGCTGTCTCACAGTGG - Intergenic
984523412 4:180827367-180827389 GTCCCAAGGATCTCCCCGTGAGG + Intergenic
984591156 4:181619106-181619128 TACCCAAGCCTCTCCCAAGGGGG + Intergenic
984761118 4:183363827-183363849 TTTCCCAGGTTCTCCCAGAGTGG - Intergenic
987910750 5:24141094-24141116 TTCCCAAGGCTCTACCTCAGTGG - Intronic
988798398 5:34673824-34673846 TTCCCAATTCTCACCCAGAGAGG + Intronic
988899538 5:35717747-35717769 TTCCCAAGGCTCCACCTTAGTGG + Intronic
990492931 5:56319842-56319864 TTCCAAAGGCGCCCCCTGAGGGG + Intergenic
993042038 5:82825154-82825176 TTCTCAAGGCTTCCCCAGACAGG - Intergenic
995564582 5:113420702-113420724 TTCCCAAGGGTCTCTCAAATCGG + Intronic
996101919 5:119452858-119452880 TTCCCAAGGTCCTGCCTGAGAGG + Intronic
996661514 5:126009098-126009120 TTCCCAAGGCTCCACCTCAGTGG - Intergenic
999126614 5:149250685-149250707 TTCCCAAGCCCCTCCCATGGGGG - Intronic
999553611 5:152717530-152717552 TTCCCAAGGCTCCACCTCAGTGG - Intergenic
1001642776 5:173256832-173256854 CACCCAGGGCCCTCCCAGAGTGG - Intergenic
1003389786 6:5703799-5703821 ATCCCAGAGCTCTCCCACAGAGG + Intronic
1003451495 6:6237800-6237822 TTCCCAGGGCTAGCACAGAGTGG + Intronic
1006379773 6:33690789-33690811 TTCCCAAGGCTCCTCCAGGGAGG - Intronic
1006640062 6:35485297-35485319 CTCACAAGGCTCTCACAGGGTGG - Intronic
1007949015 6:45853078-45853100 TGCCCAAGGCCCTCCCAGCAAGG + Intergenic
1009908371 6:69895650-69895672 TTCCCAAGGCTCCACCTCAGTGG + Intronic
1010669743 6:78674032-78674054 TTCCCAAGGCTCCACCCCAGTGG + Intergenic
1017720808 6:157241791-157241813 TTTCCAAGGCTCTGCCAGGCTGG - Intergenic
1019586413 7:1806583-1806605 TTCCCAATTCACTCCCGGAGTGG - Intergenic
1020686250 7:11298912-11298934 TTCACAAGGATCTACCAGAGTGG - Intergenic
1021939020 7:25661067-25661089 TTACCAATGCTCTCCCAGACCGG + Intergenic
1025100183 7:56128162-56128184 CTCCCAAAGTTCTGCCAGAGAGG + Intergenic
1026455809 7:70571694-70571716 TCCCCAAGGCTCCTCCACAGAGG - Intronic
1029918126 7:104232818-104232840 TTCCAGAGACTCTCCCATAGGGG + Intergenic
1030139680 7:106291911-106291933 TTCCCAAGTCTCCCCCTCAGTGG - Intergenic
1032786546 7:135205297-135205319 TTCCCAAGACTTTACCACAGTGG + Intronic
1034909068 7:154977509-154977531 TTTGCAAGGATCTCCCAGATGGG - Intronic
1036094505 8:5709035-5709057 AGCCAAATGCTCTCCCAGAGTGG - Intergenic
1036822877 8:11954104-11954126 TTCTCAAAGCTCCCCAAGAGGGG - Intergenic
1038427645 8:27474579-27474601 ATCCCAAAGCTCTCCCAGAATGG + Intronic
1038524852 8:28263933-28263955 TTCCCAAGTCTCTACCCCAGTGG + Intergenic
1040289654 8:46117786-46117808 TCCCCAAGGCTGTCCCAGGCAGG - Intergenic
1040644549 8:49382865-49382887 TTCCCTAGGTTCTCCTAGTGTGG - Intergenic
1040879749 8:52192050-52192072 TTCCCAGGGCTGGCACAGAGGGG + Intronic
1049223735 8:141439910-141439932 ATCCCAGGGCTCACCCAGAGAGG - Intergenic
1049459944 8:142721888-142721910 TTGCCAGGGCCTTCCCAGAGAGG - Intergenic
1050761504 9:9077660-9077682 TTCACAAGGCTCTCCCAATCAGG - Intronic
1057847930 9:98539658-98539680 TTCCCAAAGTGCTCCCAAAGTGG - Intronic
1058937940 9:109786298-109786320 TTCCCAAGGATCCCTCAGAGGGG + Intronic
1059994838 9:119898702-119898724 TTCCCAGGGCTCTCATAGATGGG - Intergenic
1060656334 9:125374964-125374986 GCCCCAAGGCTCCTCCAGAGAGG - Intergenic
1060734174 9:126055779-126055801 TTCCTTAGGCTCTGCCAGATGGG - Intergenic
1061192657 9:129090760-129090782 TCCTCAAGGCTGTCCCACAGAGG - Intergenic
1062067006 9:134533983-134534005 TTCCCAGGGCCCTCCCTGTGAGG + Intergenic
1062414234 9:136439713-136439735 TTCCCACCCCTCTCCCCGAGCGG - Exonic
1062566377 9:137165707-137165729 TTCTCTCGCCTCTCCCAGAGGGG + Intronic
1203770014 EBV:45144-45166 GCCCCGAGGCTCTCGCAGAGTGG + Intergenic
1203446084 Un_GL000219v1:57703-57725 ATCCCAAGGGCCTCGCAGAGGGG + Intergenic
1186846608 X:13536913-13536935 TTATAAAGGATCTCCCAGAGTGG + Intergenic
1187191017 X:17035122-17035144 TTCCTGAGGCTCTGTCAGAGTGG + Intronic
1187552613 X:20321448-20321470 TTCTCAAGGATCTCCCAGTATGG + Intergenic
1189020931 X:37338922-37338944 TTGCCCAGGATCACCCAGAGAGG + Intergenic
1189578874 X:42384598-42384620 GTCCCAAGGTTCTCCCAGGCAGG + Intergenic
1190761561 X:53441819-53441841 CTCACAAGGCGCTCCCAGTGCGG + Intergenic
1192848697 X:74931103-74931125 TTTCAAAGGCTCACCCCGAGAGG - Intergenic
1193468987 X:81876557-81876579 TTCCCAAGCCTGTCCCGCAGCGG + Intergenic
1195681575 X:107551075-107551097 TTCCAAAAGCTCTCTAAGAGTGG - Intronic
1195871088 X:109486817-109486839 TTCCCAAGGATCTGCCAAAGGGG - Intergenic
1195953294 X:110301506-110301528 TTCCCAAGGAGCTGCCAGACAGG + Intronic
1198498671 X:137220431-137220453 TTCCCGAGGCTCTACCTCAGTGG - Intergenic
1199407265 X:147477135-147477157 TTCCCAAGGTTCTTCCTGGGAGG + Intergenic
1200166347 X:154038257-154038279 TCCCCAAGGCTGTCCCCCAGGGG + Intronic
1200667823 Y:6049510-6049532 TTCCCAAGGCTGGTCCAGAATGG - Intergenic
1200906130 Y:8484723-8484745 TTCTCAAGGCAAGCCCAGAGAGG - Intergenic
1201126058 Y:10915393-10915415 TTTTCAAGGCTCTGCCAGAGGGG + Intergenic