ID: 962406424

View in Genome Browser
Species Human (GRCh38)
Location 3:135104309-135104331
Sequence CTTTCCCAGCCCACTCATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962406424_962406426 5 Left 962406424 3:135104309-135104331 CCGTAATGAGTGGGCTGGGAAAG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 962406426 3:135104337-135104359 TTAGTAAGCCAGAGTCTCCTCGG 0: 1
1: 0
2: 0
3: 15
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962406424 Original CRISPR CTTTCCCAGCCCACTCATTA CGG (reversed) Intronic
902435839 1:16397711-16397733 CTTTCTCAGCCCACTCAATCAGG + Exonic
903045663 1:20562632-20562654 CTTTCCCAGTCTCCACATTATGG + Intergenic
904535955 1:31199547-31199569 CTGGCCCAACCCCCTCATTAGGG + Intronic
904814385 1:33183974-33183996 CTTTCCCCACCCCCTCATTAGGG - Intergenic
905608243 1:39324066-39324088 TTTTCACAGCCCACTTATTTAGG + Intronic
906867586 1:49439603-49439625 ATTTCCCAGCCCACTGACTCAGG - Intronic
907340488 1:53731874-53731896 CCTTCCCAGCCCAGTCAGTGTGG + Intronic
908489646 1:64630620-64630642 CTTTCCCTCCCCACACATTCTGG + Intronic
913300304 1:117363037-117363059 CTTTTCCAAACCAATCATTATGG + Intergenic
915857438 1:159404841-159404863 GTTTCCCAGCCTACTCTATAGGG + Intergenic
916064430 1:161124522-161124544 CTTTCCCTGCCCTTTCAGTACGG - Exonic
921423723 1:214978305-214978327 CTTTCCATGCCCACTTGTTATGG + Intergenic
1067525176 10:47034163-47034185 CTCTCCCAGCCCATTCTTAATGG - Intergenic
1067681148 10:48442000-48442022 CTTACCCAGCCCACCATTTATGG - Intergenic
1070239055 10:74659875-74659897 CTTCCCCAGCCCACTGACTTTGG + Intronic
1071159652 10:82730792-82730814 CTTTCCCCAGCCACTCATCACGG - Intronic
1071446474 10:85753386-85753408 CTTTACCAGCCGAATCATTTAGG - Intronic
1072026372 10:91463348-91463370 CTTCCTCAGCCTACTCAATAAGG - Intronic
1073042097 10:100614765-100614787 CTTTTCCAGCCTACTCAGAAGGG + Intergenic
1075545223 10:123350201-123350223 CTTTCCCATCCCAGGCACTATGG + Intergenic
1077429443 11:2508733-2508755 CTTTCCCATCCCTCCCATTCGGG - Intronic
1077647643 11:3939941-3939963 TTTTCCCTTCCCACTCCTTAGGG - Intronic
1077955442 11:7014616-7014638 CTTTCCCACCCCTCTCCTAAAGG - Intronic
1078423495 11:11231069-11231091 CTTCCCCAGCCCTGTCATGAAGG - Intergenic
1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG + Intronic
1079247391 11:18762564-18762586 CTTTCCCATCCCCCTCTTCATGG + Intronic
1084737301 11:71113794-71113816 CTTTCCCAGCCCAGGCTTTTAGG - Intronic
1084966103 11:72745537-72745559 CTTGCCCAGCTCACACATCAAGG + Intronic
1089847257 11:121468083-121468105 CTTTCCCCACCCACTCCTTGAGG - Intronic
1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG + Intronic
1091119837 11:133047691-133047713 CATCCCCAGCCCACTCCTCAGGG + Intronic
1097233117 12:57523853-57523875 CTTTCCAAGCCCAGTCCCTAGGG - Intronic
1101662113 12:106774900-106774922 CTTCCCCACCCCCCTCATTCCGG + Exonic
1107670993 13:42746136-42746158 CTTTCCCATCCCAATCTTTTAGG - Intergenic
1109180015 13:59202465-59202487 CTTCCCCAGCCCTCTGCTTAAGG + Intergenic
1112283025 13:98079421-98079443 ATTTCCAAGCCCACTCTTGAGGG - Intergenic
1113815394 13:113166496-113166518 TGTGCCCAGCCCACTCATTCTGG + Intronic
1114831332 14:26145675-26145697 CTTTCTCAGGCCACTTTTTAAGG - Intergenic
1116803417 14:49466957-49466979 CTTTCTCATCCCAATCCTTAGGG - Intergenic
1117109441 14:52434883-52434905 CTTTGCCAGCTCATTCTTTACGG - Intronic
1122631775 14:103110568-103110590 CATCCCCTGCCCACTCCTTAGGG - Intergenic
1123434254 15:20243550-20243572 CGTGCCCAGCCTCCTCATTAGGG - Intergenic
1127466731 15:59250992-59251014 CATTCCCATCCCACTCGTTTTGG + Intronic
1134060534 16:11197113-11197135 CTTTCACAGCCCACACACTCAGG - Intergenic
1136850358 16:33607561-33607583 CGTGCCCAGCCTCCTCATTAGGG + Intergenic
1138971995 16:62156198-62156220 CTTTCCCAGTCCACTAAAAATGG + Intergenic
1140836063 16:78795038-78795060 TTTTTCCAGCCAACTCATTTTGG + Intronic
1203111971 16_KI270728v1_random:1456014-1456036 CATGCCCAGCCTCCTCATTAGGG + Intergenic
1203142874 16_KI270728v1_random:1780373-1780395 CTTTCAAAGCCCACCTATTAGGG - Intergenic
1143762784 17:9117003-9117025 CTCTCCCACCCCCCTCATTCAGG - Intronic
1144380977 17:14698051-14698073 AGTTCCTAGCCCACTCATAAAGG - Intergenic
1147326676 17:39672988-39673010 CCTTCCTTGCCCACTCCTTAGGG - Intronic
1147653903 17:42077785-42077807 CTGTCCCACCCCACCCATCATGG + Intergenic
1147654358 17:42080429-42080451 CCATCCCAGCCCACTGATTCAGG + Intergenic
1148353626 17:46959008-46959030 CTTTCTCAGGCCACTCTTCATGG - Intronic
1149001834 17:51765280-51765302 CTGTCCCAGACCACTCATTGAGG - Intronic
1153981047 18:10310813-10310835 CTTTCCCTGTCCACTCATGATGG - Intergenic
1155407979 18:25511339-25511361 CTTTTCCATCCCACTAGTTAGGG - Intergenic
1156268689 18:35511673-35511695 CTTCCCCAACACCCTCATTAGGG - Intergenic
1157081152 18:44526744-44526766 CTTTTGCACCCCACTCAGTAAGG - Intergenic
1159541184 18:69778909-69778931 CATCCCCATTCCACTCATTAGGG - Intronic
1159664087 18:71136275-71136297 CTTTAACAGACCACTGATTATGG - Intergenic
1161715761 19:5875431-5875453 CTTTCCCCGCCCACTCCTGCAGG + Intronic
1167578654 19:50329554-50329576 CTTTCTCAGCCCAATCAGGACGG - Intronic
1168539640 19:57199452-57199474 CATTCCCAGCTCACCCATGATGG + Intronic
925263603 2:2548816-2548838 CCTTCTCAGCCCACTCAATGTGG - Intergenic
931064787 2:58573249-58573271 CCTTCCCCCTCCACTCATTAGGG - Intergenic
942085537 2:172439940-172439962 CTCTCCCAGCCCACTATGTAGGG - Intronic
948853915 2:240721285-240721307 CTTACCCAGCCCACTCCTCGAGG - Intronic
948884920 2:240877689-240877711 CTTGCCCAGCCCCCTCAAGAGGG + Intronic
1168914225 20:1473188-1473210 CTTTCTCAGCACACTGATTAGGG + Intronic
1169564190 20:6835372-6835394 ATTTCCCAGCACACTGATAACGG + Intergenic
1170392520 20:15890880-15890902 CTTCCCCAGCCCTTTCTTTAAGG - Intronic
1170534925 20:17331188-17331210 CTCTTCCAGCCCACTCCTTGTGG + Intronic
1171944957 20:31368337-31368359 CTTTCCCCGATCTCTCATTAGGG - Intergenic
1172495207 20:35377051-35377073 ATTTCCCAGCTCATTCAATAAGG + Intronic
1175458309 20:59131638-59131660 CTAGCCCAGGCCACTCCTTAAGG - Intergenic
1177037130 21:16058224-16058246 CTTTCCCAACCCATTTAATAAGG + Intergenic
1178958126 21:37041671-37041693 CCTTTCCAGCCCACTGATTGGGG - Intergenic
1178963007 21:37085159-37085181 CTGTCACAGCCCACACATCATGG - Intronic
1179028149 21:37697377-37697399 CTTTCCCACCCCACTTTCTATGG - Intronic
1182782145 22:32876524-32876546 ATTTCCCATCTCACTCTTTAAGG - Intronic
1183955044 22:41374797-41374819 CTTCCTCAGCCTACTCAATATGG - Intronic
950331025 3:12156356-12156378 CTATCCCAGCCAATTCAGTATGG + Intronic
951369724 3:21830466-21830488 CTTTCCCAGCGCACCTAATATGG - Intronic
952494291 3:33902438-33902460 CTTTTCTTGCCAACTCATTAAGG + Intergenic
954316738 3:49805632-49805654 CTTTCACAGCCCACTCCCAAGGG - Intronic
960582453 3:119292728-119292750 CTTTCCAGGCCCACTCAGTGAGG - Intergenic
962406424 3:135104309-135104331 CTTTCCCAGCCCACTCATTACGG - Intronic
962486016 3:135843050-135843072 CTTTGACAGTCCCCTCATTAAGG - Intergenic
973182356 4:47284748-47284770 CTTGCACAGTCCACTCTTTAGGG - Intronic
974877243 4:67715139-67715161 CTTTCTCAGACTACTCAATATGG - Intergenic
975252893 4:72199672-72199694 CTTTCTCAGCCTCCTCTTTAAGG - Intergenic
975837203 4:78436270-78436292 CTTTCCCTGACCACTAATGAAGG - Intronic
977554199 4:98472163-98472185 CTCTCCCAGCCCTCCAATTACGG + Exonic
977719139 4:100218810-100218832 CTTTCTCAGCTAATTCATTATGG + Intergenic
980166354 4:129232721-129232743 CATTCCCTGCCCACTGACTATGG - Intergenic
980712895 4:136592890-136592912 CTTTCTCAGCCTTCTCTTTAAGG - Intergenic
983274962 4:165605689-165605711 ACTTCCAAGCTCACTCATTAGGG + Intergenic
983795540 4:171857469-171857491 CCTTATCAGCCCACTCCTTATGG - Intronic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
985515099 5:338865-338887 CTTTCCCCTCCTATTCATTAGGG + Intronic
986783751 5:11091113-11091135 CTTTCTCTGTCCTCTCATTAGGG + Intronic
987474177 5:18370408-18370430 TATTCCCACCCCACTCACTATGG - Intergenic
990343092 5:54844321-54844343 AATTCCAAGCCCACTCATTCTGG + Intergenic
992769332 5:80032809-80032831 CTTTCCCAGTCCACTGACTCAGG + Intronic
994359024 5:98828996-98829018 CTTTCCCAGCCCAGCCAGAAAGG + Intergenic
997621630 5:135302521-135302543 CTTTCCCAGGCCAACCATCATGG + Intronic
997860301 5:137409700-137409722 CTTTCTCAACCCAATCATTGTGG - Intronic
998168869 5:139860343-139860365 CTTGCCCAGCTCCCTCATTGGGG + Intronic
998358217 5:141559648-141559670 CTTTCCCAGCACACCCAGGATGG + Intronic
1006858032 6:37149570-37149592 CTGTCCCAGCTCACTCATTTTGG + Intergenic
1007069144 6:39022460-39022482 CCTTCTCAGCCCACTCAATCAGG + Intronic
1008355151 6:50543937-50543959 CTTTCGCAGCCCACCCGTTCAGG - Intergenic
1009861877 6:69345129-69345151 CTTTACGAGACCACTCATAATGG - Intronic
1010408320 6:75531542-75531564 TTTCCCCAGCCCACTGATTTGGG + Intergenic
1011352240 6:86435320-86435342 CCTTCTCAGCCCACTCAATCAGG + Intergenic
1012953724 6:105546168-105546190 CTTTCCCAGGCCAGCCTTTAAGG - Intergenic
1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG + Intergenic
1017633305 6:156420492-156420514 CTTTCCCAGCACTCTCAGTTTGG + Intergenic
1018939825 6:168301743-168301765 CCTGCCCAGCCCACTCACTGCGG + Intronic
1022080311 7:27013272-27013294 CTGACCCAGCCCAGTCATAATGG + Intergenic
1028307716 7:89286991-89287013 CCTTCTCAGCCTACTCAATATGG + Intronic
1030011633 7:105174466-105174488 CTTTCTCAGCCCTCTGATTGTGG + Intronic
1031965012 7:128021472-128021494 CTTTACCTGCCCACTCATCCAGG - Intronic
1034328248 7:150257824-150257846 CTCTCCCAGCACATTCTTTATGG - Intronic
1034764968 7:153711640-153711662 CTCTCCCAGCACATTCTTTATGG + Intergenic
1037761618 8:21745443-21745465 CTTTCCCAGGACACCCATCAAGG + Intronic
1038084942 8:24185679-24185701 CTTTCCCAGCCTACTTCTTTTGG + Intergenic
1042859415 8:73297467-73297489 CCTTCCCAACCTTCTCATTAAGG - Intronic
1049960653 9:734955-734977 TTTACCCAGCCCACTCATGCTGG - Intronic
1050866750 9:10510201-10510223 CTTTCCCATACCACTCAGTATGG + Intronic
1055317148 9:75045467-75045489 CCTTCCCAGCGTACACATTAGGG + Intergenic
1190154374 X:47975938-47975960 CTGTGGCAGCCCTCTCATTAGGG + Exonic
1197723202 X:129758916-129758938 CTCCCCCATCCCACTCATTTTGG - Intronic
1200009647 X:153111477-153111499 CCTTCCCTGCCCACTCGGTAGGG + Intergenic
1200029953 X:153288445-153288467 CCTTCCCTGCCCACTCGGTAGGG - Intergenic