ID: 962407309

View in Genome Browser
Species Human (GRCh38)
Location 3:135111171-135111193
Sequence CCTAAAGGAAACCATCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962407309_962407318 29 Left 962407309 3:135111171-135111193 CCCCACTGATGGTTTCCTTTAGG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 962407318 3:135111223-135111245 AAGCAGCCTCCGTGTCACCTAGG 0: 1
1: 1
2: 1
3: 62
4: 315
962407309_962407315 4 Left 962407309 3:135111171-135111193 CCCCACTGATGGTTTCCTTTAGG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 962407315 3:135111198-135111220 TGGTTTTAAAATGCAGTCCCTGG 0: 1
1: 0
2: 3
3: 30
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962407309 Original CRISPR CCTAAAGGAAACCATCAGTG GGG (reversed) Intronic
901125093 1:6923633-6923655 GCCACAGGAAACCACCAGTGTGG - Intronic
901324094 1:8356677-8356699 CCTAAAGGAGGCCAGCAGAGTGG + Intronic
904826134 1:33275155-33275177 CTTAATGGAAACCCTCTGTGAGG + Intronic
905349644 1:37336432-37336454 CCTGAAGCCAACCATCAGTGAGG - Intergenic
908776511 1:67646212-67646234 ACTGAAGGACACCATCAGTTTGG + Intergenic
910171589 1:84383628-84383650 ACTTAAAGAAACCATAAGTGGGG + Intronic
912054196 1:105574576-105574598 TCTAATGGAAACCATGTGTGTGG + Intergenic
912373709 1:109193165-109193187 CCTAAAGGGAAGGAACAGTGGGG + Intronic
915962548 1:160279205-160279227 CGTAAAGGTGAACATCAGTGTGG + Exonic
917206252 1:172573699-172573721 CCCAAAGGATACCATTAGTGGGG - Intronic
917701780 1:177589101-177589123 CATTAAGTAAACCATCATTGAGG + Intergenic
919041010 1:192388157-192388179 CCTAAAATCAACCATCAGAGGGG + Intergenic
921358494 1:214308428-214308450 CGTAAAGGAAATCATTAGGGAGG + Intronic
922121646 1:222675596-222675618 CCTTAAGTGAATCATCAGTGAGG - Intronic
923657906 1:235934226-235934248 CCTAACAGAGACCATTAGTGAGG - Intergenic
1064206082 10:13324916-13324938 ATAAAAGGAAACCTTCAGTGTGG - Intronic
1065719610 10:28613723-28613745 CCAAAAGAAAAACAGCAGTGAGG + Intronic
1067356392 10:45532261-45532283 CCTACAGTAAACCTGCAGTGAGG + Intronic
1068699677 10:60006710-60006732 CACAAAGGAAACCTTCTGTGAGG + Intergenic
1069424299 10:68276254-68276276 CCTAGAGGGAACCATCTGAGTGG + Intergenic
1072371218 10:94767962-94767984 GCAGAAGGAAACCATCAGGGAGG - Intronic
1073964057 10:108967892-108967914 CTTAAAGAAAGACATCAGTGAGG + Intergenic
1074045417 10:109833526-109833548 CCTCTAGGAAACCATCTCTGAGG + Intergenic
1074931491 10:118131154-118131176 CATAAAGGGAAGCAACAGTGGGG + Intergenic
1075231754 10:120685822-120685844 CCCAAAGGAAACCAATAATGAGG - Intergenic
1080204164 11:29709954-29709976 CCAAAAGGAAACCATCATCAGGG - Intergenic
1081363232 11:42205283-42205305 GCCAAGGGAAACCATCAGTGAGG + Intergenic
1091138569 11:133215940-133215962 CCTGAAGGAATCCAATAGTGAGG - Intronic
1092957264 12:13562358-13562380 CCTAAATGAAAAGATCAGTTTGG + Exonic
1098011909 12:66062108-66062130 CCTGAAGAAAACAATGAGTGAGG - Intergenic
1098384502 12:69904419-69904441 CCTAGAGGAAACCAGAAGTCAGG + Intronic
1098760591 12:74420179-74420201 GCTAAATGCAAACATCAGTGTGG - Intergenic
1099413028 12:82355385-82355407 CTTAAAGCAAACACTCAGTGTGG - Intronic
1100332274 12:93595224-93595246 CCTAAAGTTAACTATCAGTGTGG - Intergenic
1102409707 12:112707069-112707091 GCTGAAAGAAACCCTCAGTGTGG - Intronic
1106710801 13:32330135-32330157 CCTAAACGAAAACTTCAGTAAGG - Intronic
1107199352 13:37695306-37695328 TCTGAAGGACACCCTCAGTGAGG + Intronic
1109466677 13:62743368-62743390 ACTAAAGGAAATTCTCAGTGTGG - Intergenic
1117744366 14:58853152-58853174 CCTAGAGGAAGCTGTCAGTGAGG + Intergenic
1128691800 15:69730154-69730176 ACTAAATGAAACCATTAGTGAGG + Intergenic
1132888622 16:2193761-2193783 CCTTGAGGAGACCATAAGTGGGG - Intronic
1134046816 16:11107200-11107222 TGTAAAGGAAACCAGCAATGAGG - Intronic
1134879446 16:17732125-17732147 CCTCAAGGAAATCACTAGTGTGG - Intergenic
1137802347 16:51272898-51272920 TCTAAAGGAGACCTTCAGAGTGG + Intergenic
1138893625 16:61175927-61175949 GAAAAAGGAAACCATCTGTGAGG - Intergenic
1139959005 16:70707006-70707028 CCTAAAGGATCCCAGCTGTGGGG - Intronic
1144689105 17:17248050-17248072 CCTAAAGGGGACCGTCAGGGAGG + Intronic
1146594387 17:34156505-34156527 CCTCAAGGAAAGCCCCAGTGAGG - Intronic
1148139748 17:45319797-45319819 CCTAGAGGGAACATTCAGTGAGG - Intergenic
1148448702 17:47759003-47759025 CCTTAAGGAAACCATAAGGAAGG + Intergenic
1148563525 17:48619888-48619910 CCTAAAGCAAACGCTCAGCGAGG - Intronic
1148893236 17:50823050-50823072 TCTAAAGGAAACCTTCAAAGAGG + Intergenic
1153337075 18:3935952-3935974 CCTTAAGGAAGCCAACATTGGGG - Intronic
1155705447 18:28804992-28805014 CCTAAAGTAAACAGTCAGAGAGG - Intergenic
1157608836 18:48943319-48943341 TCTAAAGGTAAAAATCAGTGAGG - Intronic
1157884002 18:51348827-51348849 CCAAAAGGAAGACATCACTGGGG - Intergenic
1158023024 18:52866157-52866179 CCTAACGAAAACAAGCAGTGCGG - Intronic
1158091180 18:53715547-53715569 CCTAAATTAAATCTTCAGTGGGG + Intergenic
1158622517 18:59045391-59045413 CCTAAAGGAGACCGTCAGCTAGG - Intergenic
1162743616 19:12786870-12786892 ATTAAAGGAGACCCTCAGTGGGG + Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925697293 2:6594468-6594490 CCGAACAGAAACCATCAGTTTGG - Intergenic
925910438 2:8570190-8570212 CCAAAGGGAAACCTTCTGTGAGG - Intergenic
927245966 2:20957465-20957487 CCTCAAGAAATCCAACAGTGTGG - Intergenic
931075242 2:58703659-58703681 AGTAAATGAAAACATCAGTGAGG + Intergenic
931170443 2:59797896-59797918 CCAAAAGGAAACCATGAATAAGG + Intergenic
933514883 2:83288114-83288136 CCAAAAGGGAACCAGCAGTGGGG - Intergenic
936893182 2:117395887-117395909 CCTAAAGGAAACCCTGCATGGGG - Intergenic
937239377 2:120450509-120450531 CCTAAATGACAGCATCAGCGGGG - Intergenic
939166518 2:138646691-138646713 CGTAAAGGAAGCCATGAGGGAGG + Intergenic
940821284 2:158359159-158359181 CATAAAGTAAAACATAAGTGAGG + Intronic
941347278 2:164386117-164386139 CCTAAAGGAAACCAGCATGGTGG - Intergenic
947848325 2:233263541-233263563 GCTTTATGAAACCATCAGTGAGG - Intronic
1169486610 20:6039911-6039933 CCCAAATCAAAGCATCAGTGGGG - Exonic
1171069265 20:22050609-22050631 AATAATGGAAACCATGAGTGGGG - Intergenic
1171088592 20:22262735-22262757 CTTAAAGGAATCCACGAGTGAGG + Intergenic
1172015949 20:31872998-31873020 CATAAAGGAAAGGGTCAGTGAGG - Intronic
1174332955 20:49835292-49835314 GCTGGAGGCAACCATCAGTGGGG + Intronic
1178112473 21:29382719-29382741 CCACAAGGAAACCAAGAGTGGGG - Intronic
1182306931 22:29376370-29376392 AATGAAGGAGACCATCAGTGTGG + Intronic
1183639050 22:39082289-39082311 CTTAAATGAGACCTTCAGTGTGG - Intronic
950126505 3:10513196-10513218 CCTCGAGGAAACCCTCTGTGAGG - Intronic
950554477 3:13686833-13686855 CCAGAAGGAAACCCTCAGTTGGG + Intergenic
955018720 3:55097654-55097676 CCTCAAGGAAAGCATTACTGAGG + Intergenic
955820624 3:62892022-62892044 CCTAAAAGATACTATCTGTGTGG + Intergenic
956648129 3:71476802-71476824 ATTAAAGAAAACCATCAATGCGG - Intronic
959229395 3:103629357-103629379 CCAAAAAGAGATCATCAGTGTGG + Intergenic
962407309 3:135111171-135111193 CCTAAAGGAAACCATCAGTGGGG - Intronic
963712264 3:148759926-148759948 CGGAAAGGAAACCAGCAGTCAGG + Intergenic
963958250 3:151279597-151279619 CCTCAATCAAAGCATCAGTGAGG - Intronic
965530672 3:169767540-169767562 CAGAAAGGAAAATATCAGTGTGG - Exonic
965975851 3:174621136-174621158 ACTAAAGGAAACTAGAAGTGTGG - Intronic
967387795 3:188928081-188928103 TATTAAGGAAAACATCAGTGGGG + Intergenic
968074517 3:195809203-195809225 CCTTAAGGAAACCCTCATTGCGG + Intronic
968643790 4:1728499-1728521 CCTTGAGGAAAGCAGCAGTGAGG + Exonic
971478129 4:27091078-27091100 CCCACAGGAGACCACCAGTGGGG - Intergenic
972240492 4:37186799-37186821 CATAAAGGAAAGCAAGAGTGAGG + Intergenic
976007914 4:80452803-80452825 ACTAATGGAAAACATCAATGCGG - Intronic
980446175 4:132910901-132910923 CTTAATGGAAACAATTAGTGTGG + Intergenic
980654377 4:135763220-135763242 CTTAAAGGAAATGATCATTGCGG - Intergenic
982012746 4:151122685-151122707 CCTATATGACACCTTCAGTGAGG - Intronic
986739114 5:10690198-10690220 GCTAAAGGAGACCCTCAGTCTGG - Intronic
987740956 5:21908046-21908068 CATAAAGGCCACCATCAGAGCGG - Intronic
988224359 5:28392862-28392884 GCAAAAAGAAACCATCAATGAGG + Intergenic
988635361 5:32977887-32977909 CCAAAAGGCAACATTCAGTGGGG - Intergenic
990023788 5:51160341-51160363 CTTAGAGGAGACCAGCAGTGGGG - Intergenic
990428826 5:55714577-55714599 CCTTCAGGAAACCATCAGGGAGG - Intronic
992094226 5:73345944-73345966 ACTAAAGGAAATCATGGGTGAGG + Intergenic
992429525 5:76695000-76695022 CCTAAACTAAACCAACAGTAAGG - Intronic
992733394 5:79694345-79694367 CATACAGGAAACCATGAGTTTGG - Intronic
993451742 5:88080006-88080028 TCTACATTAAACCATCAGTGTGG - Intergenic
993699378 5:91099979-91100001 CCTAAAAGAAACCAGGACTGGGG + Intronic
995547443 5:113247199-113247221 CCTACAGGAATCCAGAAGTGGGG + Intronic
998771808 5:145554268-145554290 CTTAAAAGTAACCACCAGTGTGG + Intronic
999105872 5:149070464-149070486 CCTAAAGGAAAACAAAACTGAGG + Intergenic
1002015031 5:176314329-176314351 CATAAAAGAAACCAACAATGTGG + Intronic
1005785645 6:29243118-29243140 TCTAAAGGAAGCAATAAGTGGGG - Intergenic
1006201838 6:32300103-32300125 CCTAAAGATAACCCTCTGTGTGG - Intronic
1008592051 6:53003874-53003896 CTTTAAGGCAACCATAAGTGAGG + Exonic
1011680334 6:89777285-89777307 TGTAAAGGACACCATGAGTGTGG + Intronic
1011720994 6:90156495-90156517 CCTGAAGTAAACCATGAGAGTGG - Intronic
1013715543 6:112956609-112956631 CCTATTTGAAACAATCAGTGAGG + Intergenic
1016062334 6:139643919-139643941 CTGAAAGGAATCCAGCAGTGAGG - Intergenic
1017430008 6:154361664-154361686 CCTGAATGAAACCATCAATTAGG + Intronic
1020312925 7:6883025-6883047 CCTTTAGGAAACCCTCAGTAAGG + Intergenic
1021242791 7:18225033-18225055 TTTAAAGGAAAGGATCAGTGAGG - Intronic
1021734476 7:23629330-23629352 CCTAGAAGACACCATCTGTGAGG + Intronic
1024657750 7:51466181-51466203 CATAAAGAAAAGCATCAGAGAGG - Intergenic
1027919408 7:84373216-84373238 CCTTAAAGAAACCATCAGCTTGG - Intronic
1029658927 7:101946063-101946085 CCCAGAGGAAACCAGCAGTCAGG + Intronic
1030752857 7:113252364-113252386 CATAAAGAAATCGATCAGTGTGG + Intergenic
1031726152 7:125242042-125242064 CCTTATGAAAACCATCACTGTGG + Intergenic
1035690110 8:1554487-1554509 CGTGAAGGAAACCAGCAGGGAGG - Intronic
1036904838 8:12699516-12699538 CCTTCAGGAAACCCTCAGTAAGG + Intergenic
1039246023 8:35609517-35609539 CCTAAAGGACACCACGACTGTGG - Intronic
1039533993 8:38291306-38291328 ACTAAATGAAACCATCTGTGAGG + Intronic
1039708046 8:40027198-40027220 CCTGAAGAAAACCATCTTTGAGG - Intergenic
1043077372 8:75719137-75719159 CCTAACAGAAACCACCAGTGGGG - Intergenic
1043846338 8:85168225-85168247 ACTTAAGGAATACATCAGTGAGG - Intergenic
1045230330 8:100299907-100299929 CCTAAAGGACACCATGAGTAAGG + Intronic
1045504677 8:102770047-102770069 CCTACAGGAAACCAGATGTGAGG - Intergenic
1048956514 8:139541610-139541632 CTTAAAGGCAACCATTAGTTTGG - Intergenic
1050378048 9:4993646-4993668 CCTCAAGGAGACTGTCAGTGAGG - Intronic
1052021533 9:23531129-23531151 CCTTATAGAAACCATCAGTGAGG + Intergenic
1057547563 9:96029578-96029600 GCAAAAGGAATCCCTCAGTGGGG - Intergenic
1188009927 X:25044601-25044623 CCCAAATGTGACCATCAGTGTGG - Intergenic
1188403300 X:29774814-29774836 TTCAAAGGAAACCATCAGTGGGG - Intronic
1190468458 X:50750787-50750809 CCTCAAGCAAACGATCAGAGTGG + Intronic
1195986815 X:110639309-110639331 CCAAAAGGACAGCACCAGTGGGG + Intergenic
1201310377 Y:12593837-12593859 CCTAAAGGAAATCGGGAGTGGGG + Intergenic