ID: 962407853

View in Genome Browser
Species Human (GRCh38)
Location 3:135115644-135115666
Sequence GTTTACCTGATTCCACAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962407853_962407864 28 Left 962407853 3:135115644-135115666 CCCTACTGTGGAATCAGGTAAAC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 962407864 3:135115695-135115717 CTCACAGTGTGGCCTTGGGTAGG 0: 1
1: 1
2: 9
3: 58
4: 381
962407853_962407861 23 Left 962407853 3:135115644-135115666 CCCTACTGTGGAATCAGGTAAAC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 962407861 3:135115690-135115712 CCTTCCTCACAGTGTGGCCTTGG 0: 1
1: 1
2: 1
3: 67
4: 534
962407853_962407858 17 Left 962407853 3:135115644-135115666 CCCTACTGTGGAATCAGGTAAAC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 962407858 3:135115684-135115706 TCCACTCCTTCCTCACAGTGTGG 0: 1
1: 0
2: 3
3: 32
4: 281
962407853_962407862 24 Left 962407853 3:135115644-135115666 CCCTACTGTGGAATCAGGTAAAC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 962407862 3:135115691-135115713 CTTCCTCACAGTGTGGCCTTGGG 0: 1
1: 0
2: 17
3: 122
4: 820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962407853 Original CRISPR GTTTACCTGATTCCACAGTA GGG (reversed) Intronic
903620715 1:24696069-24696091 ATGTCCCTTATTCCACAGTAGGG - Intergenic
904343104 1:29850866-29850888 GTCTCCCTGATTCCACAGCTTGG + Intergenic
904343525 1:29853363-29853385 GTCTCCCTGATTCCACAGCTGGG + Intergenic
904875847 1:33653902-33653924 GTATACCTGACTCCAAAGTTAGG + Intronic
905088653 1:35408351-35408373 TTTTACAGTATTCCACAGTATGG - Intronic
905144838 1:35880077-35880099 GTTTACCTGAATCAACAAGATGG - Intronic
909566918 1:77062822-77062844 GTTTTTCTGATTACACAATAAGG - Intronic
910084909 1:83388967-83388989 GTTTGCCTGATTCCAGAATCAGG + Intergenic
911585445 1:99684897-99684919 GTCCACCTGATTCCACAGCTAGG + Intronic
912384598 1:109264993-109265015 GCTTACCTGGTCTCACAGTATGG - Exonic
915800653 1:158789257-158789279 CTTTAGCTGATTCCACATTTTGG + Intergenic
917074618 1:171191410-171191432 GTTTAACTGATTCAAAACTATGG + Intronic
919732191 1:200920408-200920430 GTTTAGCTGATTCCACCAGATGG - Intergenic
921018908 1:211218296-211218318 GTTAACAGGATACCACAGTAGGG - Intergenic
921187470 1:212682968-212682990 GTTTTGCTGAATCCACAGGAGGG - Intergenic
922302276 1:224311970-224311992 GTTTCTCTGATTCCAGAGTTTGG - Intronic
1065137997 10:22691616-22691638 CCCTACCTGATTCCACAGTGAGG + Intronic
1066217059 10:33298231-33298253 GTCTACCTGATTACCCAGCAGGG - Intronic
1067483399 10:46622072-46622094 TTTTGCCTGATTCCAGAGGATGG - Intergenic
1067611358 10:47719573-47719595 TTTTGCCTGATTCCAGAGGATGG + Intergenic
1067761273 10:49048922-49048944 GTTTAACTGATTACACATTTTGG + Intronic
1069381827 10:67849591-67849613 GTTTACCTACTTCCAGACTAGGG - Intergenic
1070241697 10:74688586-74688608 GTTGACCTGATCCTAAAGTATGG - Intronic
1071626777 10:87179815-87179837 TTTTGCCTGATTCCAGAGGATGG + Intronic
1072258887 10:93647981-93648003 GTTTATATGATACCACAGTGAGG + Intronic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1086176181 11:83893701-83893723 GTTTACCTGATTCCAACTCATGG - Intronic
1087081785 11:94177931-94177953 TTTTCCCAGATTCCAGAGTAGGG + Intronic
1089774393 11:120826328-120826350 GATTATCTGATTCCACATTCTGG - Intronic
1092793937 12:12092367-12092389 CTTTACATGCTTCCCCAGTAGGG + Intronic
1093208138 12:16275727-16275749 GTTTGCCAGATTCCAAAGTTGGG + Intronic
1099345547 12:81495238-81495260 GTTTACCTGAATGCCAAGTATGG + Intronic
1106367995 13:29102101-29102123 GATTACATCATTACACAGTAGGG + Intronic
1112213443 13:97404526-97404548 GGTTACTTGATTCCACTGTGAGG - Intergenic
1114726178 14:24940287-24940309 GGTTACCTGTTCCCACAGAAGGG - Intronic
1118424257 14:65642182-65642204 GTTTACGTGATTCCTCAAAATGG - Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1124554857 15:30715747-30715769 GTGTACCTGGTTCCACTGTGTGG + Intronic
1124676390 15:31689933-31689955 GTGTACCTGGTTCCACTGTGTGG - Intronic
1125132551 15:36300648-36300670 TTTTGCCTGATTCTACAGTTAGG + Intergenic
1125284846 15:38081568-38081590 GTCTACCTGATTCTAGAGTCTGG - Intergenic
1126304620 15:47241470-47241492 GTTTGCCTGGAGCCACAGTAGGG + Intronic
1131473820 15:92719076-92719098 TTTTAGCAAATTCCACAGTATGG + Intronic
1132218916 15:100090444-100090466 CTTTCCCTCATTCCACAGCAAGG + Intronic
1133817345 16:9208223-9208245 GTCTTCCTGTTTCCACAGTGGGG + Intergenic
1139934488 16:70559310-70559332 GTTCACCTGTTTTCAGAGTAAGG + Intronic
1140833500 16:78772684-78772706 GTTTAGCTCATTCCACAGGAGGG + Intronic
1142880372 17:2878785-2878807 GTTTGCCTGAGTCCACCGTGGGG - Intronic
1151097919 17:71520639-71520661 TTGTACCTGCTACCACAGTAAGG - Intergenic
1152269092 17:79313444-79313466 GTTTACCTGTTTCCACCCTGAGG + Intronic
1153286429 18:3459314-3459336 GTTTAGCTCTTTCTACAGTAGGG - Intronic
1159909106 18:74127020-74127042 GTTTCTCTGACTCCACAGTGAGG - Intronic
1164270815 19:23670125-23670147 TTTCACCTGATTCCACTGTGGGG + Intronic
929320500 2:40538339-40538361 ATTTTCCTAATACCACAGTAGGG - Intronic
933386792 2:81621138-81621160 GTTTGTCTTATTTCACAGTAAGG + Intergenic
943181508 2:184548498-184548520 GTTTATCAGGTTCAACAGTAAGG - Intergenic
945035138 2:205697896-205697918 GTGTGGCTGATCCCACAGTATGG + Intronic
945327616 2:208501149-208501171 GCTTCCCTGATTCTACATTATGG - Intronic
1169997995 20:11580672-11580694 GTTTACCTGAGAACATAGTAAGG - Intergenic
1170468170 20:16642028-16642050 GTCTGCGTGATTGCACAGTAAGG + Intergenic
1172148180 20:32772080-32772102 AATTACCTGCTTCCACAATAGGG - Intronic
1174952584 20:55059081-55059103 GTTTTCATGCTTCAACAGTAGGG - Intergenic
952775506 3:37042127-37042149 GTTAACCAGATTCCACAGCCAGG + Intronic
962002815 3:131317280-131317302 TTTGACCTGATTCCTCAATAAGG + Intronic
962407853 3:135115644-135115666 GTTTACCTGATTCCACAGTAGGG - Intronic
964219549 3:154327664-154327686 CTGTACCTGATTCCAAAGGAAGG - Intergenic
979917607 4:126456068-126456090 GTATTCCTGATTGCACAATAAGG - Intergenic
981184781 4:141788133-141788155 GTGGACCTGATTGCACAGTCAGG - Intergenic
981955774 4:150471409-150471431 GTTTACATGATTCTAGAGCAAGG - Intronic
983960486 4:173747255-173747277 ATTTGCCTCATTCCACAGTCAGG + Intergenic
984516166 4:180742999-180743021 TTTTACTAGATTCCACAGAATGG + Intergenic
984640623 4:182160337-182160359 GGTTACCTTTTTCCACATTACGG + Intronic
987449440 5:18063602-18063624 GTTTACCTTATTTGAAAGTAGGG - Intergenic
996545196 5:124670612-124670634 GGTTAACTGATTCTAAAGTAGGG - Intronic
999718744 5:154382807-154382829 GTTATCCTCATTGCACAGTAAGG + Intronic
1000387502 5:160688573-160688595 GTGTTCCTGATTTCACAGTGAGG - Intronic
1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG + Intergenic
1001110612 5:168893221-168893243 GTTCACCTGATTCAAAAGGATGG + Intronic
1009899946 6:69798072-69798094 GCTTACCTGAGTCCACAGGGAGG + Intergenic
1017036115 6:150268860-150268882 GTTGGTCTGATTCCAGAGTAAGG + Intergenic
1021141577 7:17032283-17032305 GGTTTCCTGATGCCACAGTGTGG + Intergenic
1023371872 7:39519855-39519877 GTTCACTTGAGACCACAGTAAGG + Intergenic
1027301729 7:76845062-76845084 GTTTGCCTGATTCCAGAGTCAGG + Intergenic
1032486587 7:132292251-132292273 ATTTACCTGATACCACACTGGGG - Intronic
1038362429 8:26894260-26894282 GTTTCACTGATTCTACATTATGG + Intergenic
1045945128 8:107786887-107786909 GATTACATGATTCCATGGTAGGG + Intergenic
1045945241 8:107788432-107788454 GATTACATGATTCCATGGTAGGG - Intergenic
1048099140 8:131328618-131328640 GACTACCTGGTTCCACAGTAGGG + Intergenic
1048563130 8:135564113-135564135 CTTTCCCTGTTTCCACACTATGG + Intronic
1051991701 9:23160637-23160659 GATTGCATGATTCCACAGTCAGG - Intergenic
1057644884 9:96864667-96864689 CTTTACTTAATTTCACAGTAAGG + Intronic
1060872793 9:127056183-127056205 GTTTCCCTGAGTCCCCAGCAAGG - Intronic
1187958675 X:24546125-24546147 GTCTACCTGAAGCCACAGTGTGG - Intergenic
1188674368 X:32920676-32920698 GTTTACTTCATGCCACACTATGG + Intronic
1189196574 X:39158755-39158777 GTTTACCTGGATCCACTGAAAGG - Intergenic
1189599858 X:42612330-42612352 ATTGACATGATTCCACAATACGG - Intergenic
1191861969 X:65673123-65673145 GTTTATTTCTTTCCACAGTAAGG - Intronic
1192462492 X:71329154-71329176 TTTTACCTGCTCCCACATTATGG - Intergenic
1195418106 X:104642043-104642065 GATTGCATGATTCCACAGTGTGG + Intronic
1196184679 X:112733347-112733369 TTTTTCTTGACTCCACAGTAAGG + Intergenic
1198140912 X:133802561-133802583 CTCTTCCTGATTCCACAGGAAGG + Intronic