ID: 962409469

View in Genome Browser
Species Human (GRCh38)
Location 3:135128581-135128603
Sequence CAGAACCCAGCATTGTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962409459_962409469 24 Left 962409459 3:135128534-135128556 CCTGGCTTGCCAGCCCTGGAGCG 0: 1
1: 0
2: 1
3: 25
4: 175
Right 962409469 3:135128581-135128603 CAGAACCCAGCATTGTTAGGAGG 0: 1
1: 0
2: 2
3: 9
4: 116
962409466_962409469 10 Left 962409466 3:135128548-135128570 CCTGGAGCGGGCCTCATGGGAAT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 962409469 3:135128581-135128603 CAGAACCCAGCATTGTTAGGAGG 0: 1
1: 0
2: 2
3: 9
4: 116
962409467_962409469 -1 Left 962409467 3:135128559-135128581 CCTCATGGGAATAAGAGACAGAC 0: 1
1: 0
2: 0
3: 10
4: 171
Right 962409469 3:135128581-135128603 CAGAACCCAGCATTGTTAGGAGG 0: 1
1: 0
2: 2
3: 9
4: 116
962409458_962409469 25 Left 962409458 3:135128533-135128555 CCCTGGCTTGCCAGCCCTGGAGC 0: 1
1: 0
2: 4
3: 38
4: 292
Right 962409469 3:135128581-135128603 CAGAACCCAGCATTGTTAGGAGG 0: 1
1: 0
2: 2
3: 9
4: 116
962409462_962409469 15 Left 962409462 3:135128543-135128565 CCAGCCCTGGAGCGGGCCTCATG 0: 1
1: 0
2: 1
3: 12
4: 180
Right 962409469 3:135128581-135128603 CAGAACCCAGCATTGTTAGGAGG 0: 1
1: 0
2: 2
3: 9
4: 116
962409465_962409469 11 Left 962409465 3:135128547-135128569 CCCTGGAGCGGGCCTCATGGGAA 0: 1
1: 0
2: 0
3: 12
4: 109
Right 962409469 3:135128581-135128603 CAGAACCCAGCATTGTTAGGAGG 0: 1
1: 0
2: 2
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962409469 Original CRISPR CAGAACCCAGCATTGTTAGG AGG Intronic
901671379 1:10858185-10858207 CAGAACCCAGCGTTTTAAGCAGG - Intergenic
902441114 1:16430670-16430692 CAGAAGCCAGCATTGTTTTTGGG + Intronic
903606100 1:24576224-24576246 CAGCCCCCAGCTTTGTCAGGAGG - Intronic
906104719 1:43284937-43284959 CAGAACCAGTCATTGCTAGGCGG + Intronic
906252083 1:44318490-44318512 CAGAACCCAACATCATTAGTTGG + Intronic
909952786 1:81738995-81739017 AAGCACCCAGCATTATCAGGAGG - Intronic
910047757 1:82938481-82938503 CAGAGCCCAGCATTGTGAGGAGG + Intergenic
910555945 1:88532798-88532820 CAGACACCAGCAATGTCAGGAGG - Intergenic
914945343 1:152060578-152060600 CAGAACCCAGGTATGATAGGAGG - Intergenic
915442938 1:155957606-155957628 CAGAATCCAGCATTCAGAGGTGG - Intronic
915715542 1:157941282-157941304 CAGGACCCAGCACAGTGAGGTGG + Intergenic
915839107 1:159201263-159201285 CAAAACCCTGGAGTGTTAGGAGG + Exonic
916850090 1:168694930-168694952 AAGATCCCAGCATTGTGATGGGG - Intergenic
918691547 1:187486628-187486650 CAGAACTCAGCAGTATTAGAGGG - Intergenic
923366694 1:233268706-233268728 CAGAACACATCACTGTTAGAGGG + Intronic
1064049017 10:12043900-12043922 CAGAACCCAGTACTGTTTCGAGG - Intergenic
1064220778 10:13438866-13438888 CAGAACCCAAGATTGAGAGGAGG - Exonic
1064858018 10:19793597-19793619 CAGAACCCAGCTCTGTTATGAGG + Intergenic
1066136011 10:32446722-32446744 CACTTCCTAGCATTGTTAGGAGG + Intronic
1066779973 10:38933723-38933745 CAAAACCCAGAATTTTTGGGGGG + Intergenic
1067073076 10:43151512-43151534 CAGAACCCAGCATTCATACAGGG - Intronic
1068280474 10:54862541-54862563 CCCAACGCAGCATTGTTGGGAGG + Intronic
1070527387 10:77306958-77306980 CAGAAGCCAGTATTGGTACGAGG + Intronic
1070668420 10:78361511-78361533 CAGAACCCAGCCTGGTCAGAGGG - Intergenic
1072452954 10:95553743-95553765 CAGAAAACAGCATTGTAAGCAGG + Intronic
1075555848 10:123431309-123431331 CAGATTGCAGCACTGTTAGGGGG + Intergenic
1076647577 10:131963823-131963845 CAGGACACACCATTGTTAGGGGG - Intergenic
1077183133 11:1225227-1225249 CAAAGACCAGCTTTGTTAGGAGG - Intronic
1078151710 11:8765164-8765186 CAGCAGACTGCATTGTTAGGGGG - Intronic
1083504118 11:63139340-63139362 CAGAACACAGCATTTTGAGAGGG - Intronic
1084544449 11:69807723-69807745 CAGCACCCATCACTGTTAGATGG - Intergenic
1088217679 11:107531279-107531301 CAGAACTCAGCAGTATTATGAGG + Intronic
1090965304 11:131592834-131592856 CTGAGCCCAGCATTGTGGGGAGG - Intronic
1091876780 12:3941333-3941355 CAGAATCCAGTATTGTTTTGAGG - Intergenic
1092853920 12:12655261-12655283 CAGAGCCCAGCATTTGTTGGAGG + Intergenic
1095099214 12:38163409-38163431 CAGCACCCAGCATTCCCAGGCGG + Intergenic
1097911350 12:64973222-64973244 CACAATTCAGCATAGTTAGGAGG + Intergenic
1104742848 12:131191364-131191386 CAGGACCCAGCATGGTGTGGTGG + Intergenic
1106058786 13:26265193-26265215 CAGAACCTAGCATAGTTGGTGGG - Intronic
1112232903 13:97607351-97607373 GAGATCCTAGCATTGGTAGGAGG + Intergenic
1113709964 13:112456740-112456762 CAGAACCCTGCATTGATTTGGGG - Intergenic
1113971895 13:114197663-114197685 CAAAACCCAACATTCTGAGGTGG - Intergenic
1114411183 14:22502005-22502027 CAGAAGGCAGCTTTGTCAGGAGG + Intergenic
1120311636 14:82835579-82835601 CAAAACTTGGCATTGTTAGGTGG + Intergenic
1121947040 14:98133136-98133158 CAGTACTTAGCATTGTTAAGGGG - Intergenic
1125254087 15:37743007-37743029 ATGAACTCAACATTGTTAGGAGG + Intergenic
1127455534 15:59153069-59153091 GAGAACCCAGCCTTTTTAGCCGG - Intronic
1130920368 15:88338869-88338891 CAGAAGCCAGGAATGTTAGGTGG + Intergenic
1132222363 15:100114462-100114484 CAGAAGCCAGCATTTTTAAAAGG - Intronic
1137605238 16:49782759-49782781 CAGAACCCAGCCTGGAGAGGTGG + Intronic
1138974725 16:62190292-62190314 AACAACCCAGCAATGTTAGCAGG - Intergenic
1140255971 16:73336733-73336755 TTGAACCCAGAATTGTTAAGAGG - Intergenic
1145709282 17:26954413-26954435 CAAAACCCAGAATTTTTGGGGGG + Intergenic
1148956984 17:51362188-51362210 CATCACCCAGCATTCTTAGTGGG + Intergenic
1151639834 17:75383464-75383486 CAGTACACAGCATTGATAAGAGG - Intronic
1154518970 18:15206331-15206353 CAAAACCCAGAATTTTTTGGGGG - Intergenic
1155234954 18:23809962-23809984 CAGAAACCAGTATTTGTAGGAGG - Intronic
1157218202 18:45802881-45802903 CAGAACCCAGCATTAGTAGGTGG + Intergenic
1158498172 18:57975314-57975336 CAGAAGCCAGCATTCACAGGTGG + Intergenic
1165899232 19:39161080-39161102 CAGCACCCAGCACTGTTTAGAGG + Intronic
1168654428 19:58117402-58117424 CAGAACCCAGCAGGGATGGGAGG + Intronic
927133000 2:20076406-20076428 CGGAACCCAGGAGTGTTGGGAGG - Intergenic
938388323 2:130883514-130883536 CAGAACACAGTATTTTTAGTGGG - Intronic
938518974 2:132046878-132046900 CAAAACCCAGAATTTTTGGGGGG - Intergenic
939418875 2:141939763-141939785 TTGAAATCAGCATTGTTAGGTGG + Intronic
941059614 2:160831250-160831272 CAAAAATCAGCATTGTTTGGAGG - Intergenic
942057752 2:172200382-172200404 CAGAATCCAGCAGTGGTATGTGG - Intergenic
942546106 2:177065516-177065538 CATAACCCAGAAATGTTAAGTGG - Intergenic
943676533 2:190721305-190721327 AAGTACCCAGCATTGTAACGAGG - Intergenic
1172355572 20:34277314-34277336 CAGAACCCAGCATTTGTATGTGG - Intergenic
1174949532 20:55029017-55029039 CAGACCCCATACTTGTTAGGTGG - Intergenic
1175502342 20:59459545-59459567 CAGAACACAGCACTGAGAGGTGG + Intergenic
1175677047 20:60955504-60955526 AAGAACCCAGCATTCTTGGATGG - Intergenic
1178865325 21:36321916-36321938 TAGAGACCAGCATTGTTAGCGGG + Intronic
1180280667 22:10690732-10690754 CAAAACCCAGAATTTTTGGGGGG + Intergenic
1184298123 22:43539019-43539041 CCAAAGCCAGCAGTGTTAGGTGG + Intronic
1184589159 22:45469969-45469991 CAGTGCCCAGCAGTGTGAGGTGG + Intergenic
951201371 3:19878447-19878469 AAGAACCCACCAGTGGTAGGAGG + Intergenic
952923097 3:38300661-38300683 AAGAGCCCAGCATTGTTATTGGG + Intronic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
960525634 3:118706602-118706624 CAGACCCCAGAAATGTTAAGAGG + Intergenic
961404412 3:126668170-126668192 CAAAACCCAGCATTGCTCTGGGG + Intergenic
961474624 3:127138860-127138882 CAGAGCCCAGCAATGTTGGTGGG - Intergenic
962409469 3:135128581-135128603 CAGAACCCAGCATTGTTAGGAGG + Intronic
966713367 3:182991507-182991529 CAGAACCAAGCAGTGTGGGGAGG + Intergenic
966889443 3:184396069-184396091 GAAATCCCAGCATTTTTAGGAGG - Intronic
972711357 4:41598632-41598654 GAAAACTTAGCATTGTTAGGGGG - Intronic
975493558 4:75014099-75014121 CAGAACCCTGCATGGTCAGTTGG + Intronic
978647868 4:110962037-110962059 AATAACACAGCATTGTTATGGGG + Intergenic
981137950 4:141234845-141234867 CAGACCCCATCATTGATAGGTGG + Intergenic
986061851 5:4199192-4199214 CCCACCCCAGCATTGTTAGCTGG - Intergenic
996302033 5:121998817-121998839 AAGAACACACCAGTGTTAGGTGG + Intronic
997612845 5:135227310-135227332 CAGAACCCAGCGTGGTCAAGGGG - Intronic
999056591 5:148584631-148584653 CAGACCCCAGTTTTGTTTGGGGG + Intronic
999819724 5:155214442-155214464 CAGAATTCAGCACTGTGAGGAGG - Intergenic
1002191410 5:177479677-177479699 CAGGGCCCAGCATAGTGAGGAGG - Intergenic
1002792508 6:446532-446554 CAGAACTCAGCAGTGCAAGGCGG + Intergenic
1010040175 6:71372481-71372503 CAGGACTCAGTATTGTTAAGTGG - Intergenic
1016017867 6:139204750-139204772 CTAAACCCAGCACTGTTAGCAGG + Intergenic
1019111087 6:169714642-169714664 TAGACCCCAAAATTGTTAGGAGG + Intronic
1019371207 7:662801-662823 CAGGACTCAGCATTGCTTGGAGG - Intronic
1021026755 7:15677471-15677493 CAGAACCCCGGAGGGTTAGGTGG - Intronic
1021959450 7:25857802-25857824 CAGAAACCAGGATTGTTTGGGGG - Intergenic
1022526676 7:31042500-31042522 CATAAGCCAGCATGTTTAGGGGG + Intergenic
1024621411 7:51160603-51160625 CAGCACCCAGCATTCTTATGAGG - Intronic
1024726523 7:52203141-52203163 CAGAGGCCAGCATGGTCAGGTGG - Intergenic
1025838108 7:65114965-65114987 CAAAACCCAGAATTTTTGGGGGG + Intergenic
1025879166 7:65518118-65518140 CAAAACCCAGAATTTTTTGGGGG - Intergenic
1025884964 7:65581008-65581030 CAAAACCCAGAATTTTTGGGGGG - Intergenic
1040622350 8:49103949-49103971 AAGAACTAAGCATTGATAGGAGG - Intergenic
1041672181 8:60502648-60502670 CTGAACCCATCATTGGCAGGAGG - Intergenic
1045034857 8:98168940-98168962 AAGCACCCAGCACTGTTAGGAGG - Intergenic
1045413425 8:101943093-101943115 GAGAACCAAACATTGTTGGGGGG + Intronic
1046951383 8:120023061-120023083 CAGGAGCCAGCATGGTGAGGTGG + Intronic
1048286963 8:133149320-133149342 CTGAATCCTGCATTGTTGGGAGG + Intergenic
1052132572 9:24866983-24867005 TAGAACCCAGCATTGCCATGGGG + Intergenic
1055706790 9:79014126-79014148 CAGAACCCACATTTATTAGGTGG - Intergenic
1057282124 9:93720558-93720580 TAGCACCCAGCTTTGTGAGGAGG + Intergenic
1059991653 9:119870923-119870945 CAGAAGGGAGCATTGTTAGTAGG - Intergenic
1060642081 9:125247533-125247555 CAAAAACCAGCCTTGTTAAGTGG - Intergenic
1061200645 9:129136626-129136648 CAGAACGCAGCCTTGGTTGGGGG - Intronic
1203581916 Un_KI270746v1:15023-15045 CAAAACCCAGAATTTTTTGGGGG + Intergenic
1185932209 X:4215811-4215833 CAGTACCCAGGATTTTTATGGGG + Intergenic
1186388485 X:9133918-9133940 CAGCACCCAGCATTCTCAGGTGG - Intronic
1187701022 X:21964454-21964476 CAGACCCCTGCATTCTGAGGGGG + Intronic
1193658448 X:84226197-84226219 CAGAGCTCAGCATTTTTAGATGG - Intergenic
1195951323 X:110276931-110276953 TAGACCACAGCATTGTGAGGGGG - Intronic
1197160132 X:123313596-123313618 CAGAACTCAGAAATGTTAAGAGG + Intronic