ID: 962410682

View in Genome Browser
Species Human (GRCh38)
Location 3:135139334-135139356
Sequence CAAACCAATCCCTTTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962410682_962410685 -3 Left 962410682 3:135139334-135139356 CCACTCTCAAAGGGATTGGTTTG 0: 1
1: 0
2: 0
3: 22
4: 123
Right 962410685 3:135139354-135139376 TTGTTTGGGCATTTTAACTTTGG 0: 1
1: 0
2: 1
3: 24
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962410682 Original CRISPR CAAACCAATCCCTTTGAGAG TGG (reversed) Intronic
908298899 1:62741824-62741846 GAAAACATTCCCTTTGAGAACGG + Intergenic
913195387 1:116452318-116452340 CAAAGCAGACCCTTTGAAAGAGG + Intergenic
918843922 1:189583956-189583978 CAAAGTAATGCCCTTGAGAGTGG + Intergenic
1069437335 10:68397026-68397048 CAAACCAATCCCTGAGAGCTGGG + Intronic
1072856422 10:98952294-98952316 CAAACAAATTCTTTTGAGCGGGG - Intronic
1076602456 10:131667683-131667705 AAAACCCCTCCCCTTGAGAGTGG - Intergenic
1078809532 11:14744020-14744042 AAAACTAATCTCTTTGATAGTGG - Intronic
1078952474 11:16149940-16149962 CAAATCAATTGCTTTGGGAGTGG - Intronic
1081179068 11:39965567-39965589 AAAAACAGACCCTTTGAGAGAGG - Intergenic
1083445819 11:62707479-62707501 CAGACCACGCCATTTGAGAGGGG + Intronic
1085230090 11:74959726-74959748 CCACCCTATCCCTTTGAGTGTGG + Intronic
1087698850 11:101412784-101412806 CAAGCCAACCCCTTTGCAAGGGG + Intergenic
1091404848 12:202870-202892 CAGACCAATGCCTTCCAGAGTGG + Exonic
1091611600 12:2015085-2015107 CAAACCCATCCCTCTGAGGCAGG + Intronic
1091629295 12:2147145-2147167 CAAACGAATCACTGAGAGAGGGG + Intronic
1091918491 12:4286341-4286363 GAAACCAAGCCCTTGGAAAGAGG + Intronic
1091931400 12:4398445-4398467 CACATCAATCACTTTGAGAGCGG - Intergenic
1095797513 12:46236471-46236493 CAATCCCATCCCTTTAAGATGGG - Intronic
1096252787 12:50044078-50044100 CAATCCTATCCCTTTGAGTGTGG - Intergenic
1097705316 12:62862312-62862334 GAAAACAAGGCCTTTGAGAGAGG + Intronic
1098424545 12:70346256-70346278 AAAACCAATACCTATGAGAGGGG + Exonic
1103186460 12:118961950-118961972 CATATCAATCCCTATGAGATAGG + Intergenic
1104477447 12:129082296-129082318 TAAACCTCTCCCTTTGAGTGTGG + Intronic
1108365047 13:49702737-49702759 CCAAACAATCCATTTGACAGAGG + Intronic
1108732717 13:53251544-53251566 CACCCCACTCCTTTTGAGAGAGG - Intergenic
1110979613 13:81879578-81879600 TAATCCTATCCCTTTGAGTGTGG - Intergenic
1114058338 14:18995886-18995908 CAATCCAATCCCTTTTACAGTGG - Intronic
1114104208 14:19405868-19405890 CAATCCAATCCCTTTTACAGTGG + Intronic
1116509725 14:45729227-45729249 CAATCCAATCTCTTTAATAGAGG - Intergenic
1119760891 14:77151108-77151130 CAAGCCAATGCCTTTGATAAAGG - Intronic
1120191345 14:81442852-81442874 CATTCCAATCGCTATGAGAGGGG - Intergenic
1121016144 14:90550497-90550519 AAAAGCAAGCACTTTGAGAGAGG - Intronic
1121891191 14:97592707-97592729 CAAATTACTCCCTTTGAGTGTGG - Intergenic
1122475685 14:102007182-102007204 AAGACCAATGGCTTTGAGAGAGG - Intronic
1122596095 14:102893569-102893591 CAAACCATTCACTTTCAGTGGGG - Intronic
1133552619 16:6871880-6871902 CAATCCAGGCTCTTTGAGAGAGG + Intronic
1135858146 16:26031139-26031161 CAAACCAGTCCCATTCAGAGCGG + Intronic
1136589170 16:31206956-31206978 TATAGCAATCCCTTTGAGATAGG + Intergenic
1138828942 16:60355621-60355643 CAAAACAATCCCTAGGAGATAGG - Intergenic
1139162622 16:64529530-64529552 CAATGCTATCCCTTTTAGAGAGG - Intergenic
1142975453 17:3641077-3641099 AAAACCTGTCCCTTAGAGAGGGG + Intronic
1145974271 17:28975341-28975363 CTAGCCAGTCCCTTTGAGTGTGG - Intronic
1146983819 17:37193191-37193213 CAAACCAAACCCTTTCAGAAAGG + Intronic
1148334157 17:46830498-46830520 TAATCCCAGCCCTTTGAGAGGGG - Intronic
1148740943 17:49891825-49891847 CAAATCATTCACTCTGAGAGTGG + Intergenic
1148802074 17:50234994-50235016 GAAAATCATCCCTTTGAGAGTGG - Intergenic
1149342917 17:55705101-55705123 CAAGACAATCCTTTTGAGTGTGG - Intergenic
1150302522 17:64058157-64058179 CAAAGCAATTGCTTTGAAAGAGG - Intronic
1152358276 17:79817022-79817044 GAAACCAGTGCCTCTGAGAGTGG + Intergenic
1156525353 18:37762478-37762500 AAAGCCAGTCCATTTGAGAGTGG + Intergenic
1159301147 18:66570738-66570760 AAAACCAATCACTGTGAGAAAGG + Intronic
1164743178 19:30591788-30591810 GAAACACATCCCTTGGAGAGGGG + Intronic
927048534 2:19304067-19304089 CAAACCACTCCCTGATAGAGAGG + Intergenic
928024497 2:27728664-27728686 GAATCCATTCCCTTGGAGAGGGG - Intergenic
928026081 2:27740041-27740063 AAAAATATTCCCTTTGAGAGAGG + Intergenic
931736325 2:65198048-65198070 CAAACCAACCCGTTGGACAGTGG + Intergenic
932366443 2:71156331-71156353 CAAACCCCTCCCTCTGAGGGTGG + Intergenic
937767295 2:125676516-125676538 GAAATCATTCCCTTTGAGAATGG - Intergenic
938282867 2:130078331-130078353 CAATCCAATCCCTTTTACAGTGG + Intronic
938333501 2:130466899-130466921 CAATCCAATCCCTTTTACAGTGG + Intronic
938356312 2:130653772-130653794 CAATCCAATCCCTTTTACAGTGG - Intronic
938432745 2:131260574-131260596 CAATCCAATCCCTTTTACAGTGG - Intronic
938476752 2:131622828-131622850 CAATCCAATCCCTTTTACAGTGG - Intergenic
938632641 2:133184794-133184816 CAAACCAACCCCTTAAAAAGTGG - Intronic
938939244 2:136154550-136154572 TAAACCAGTCCCTTTAGGAGCGG + Intergenic
941394858 2:164961773-164961795 CAAAACTACCACTTTGAGAGAGG - Intergenic
948572346 2:238925523-238925545 CAAAGCCTTCCCTTTGAGCGCGG + Intergenic
1170153053 20:13245487-13245509 CAATCCCCTCCCTTTGAGTGTGG - Intronic
1170181350 20:13533824-13533846 CAAACCAATTACTATGAGATAGG + Intronic
1174576514 20:51541687-51541709 CAGACCAATCCTCTTGTGAGTGG + Intronic
1177569936 21:22874424-22874446 CAGAACAATACCCTTGAGAGAGG + Intergenic
1177746317 21:25218080-25218102 CAAACCCATCCCTGTGAGTGGGG - Intergenic
1180476826 22:15718505-15718527 CAATCCAATCCCTTTTACAGTGG - Intronic
949855413 3:8456904-8456926 AAACCCAATTCATTTGAGAGGGG - Intergenic
954857678 3:53660626-53660648 CAAACCCACCACTTTCAGAGGGG - Intronic
958264190 3:91418441-91418463 CAAACCATTTCCCTTGAGAATGG + Intergenic
959064845 3:101645947-101645969 AAAGCCAATCCCTTTGAGACTGG - Intergenic
959212199 3:103399906-103399928 GAAAACAATCCCTTTTATAGTGG - Intergenic
960323512 3:116266381-116266403 CAAGCCAAGAACTTTGAGAGAGG + Intronic
960728761 3:120700727-120700749 CAAAATAATCCAGTTGAGAGTGG + Intronic
961411034 3:126720488-126720510 CAAACCAGGCCCTTTGAGGGAGG - Intronic
962173182 3:133124642-133124664 AAAGCCAACCCCTTTTAGAGGGG + Intronic
962410682 3:135139334-135139356 CAAACCAATCCCTTTGAGAGTGG - Intronic
963306723 3:143661571-143661593 TAAACCCATCCCTTTAATAGAGG + Intronic
963744655 3:149114263-149114285 CAAACCCATCCTATTGAGAGAGG - Intergenic
964323898 3:155526215-155526237 CAATCCCCTCCCTTTGAGCGTGG + Intronic
965672184 3:171158256-171158278 CAAACCAAGCCCTTTAAGTGTGG - Intronic
965685925 3:171302319-171302341 CAGACAAATCTCTTTGAGTGTGG - Intronic
970009889 4:11447398-11447420 AAAATCAATCCCTTTGAGGCTGG - Intergenic
975404477 4:73974186-73974208 CAAACAACTCCCTTTAAAAGTGG + Intergenic
978015995 4:103747339-103747361 CAAACCAATCCATTTTTAAGTGG - Intergenic
982508597 4:156251734-156251756 TAATCCCTTCCCTTTGAGAGTGG - Intergenic
983872601 4:172839151-172839173 CAACCCACACCCTTTGGGAGGGG + Intronic
988452207 5:31354650-31354672 CAAATCAATCCCATTAAAAGAGG - Intergenic
988632161 5:32943190-32943212 CAAACCACTCACTTTGGTAGTGG + Intergenic
990822565 5:59858825-59858847 CAAAGAAATCCCCTTGAGACTGG - Intronic
991699091 5:69300559-69300581 CAAACCAAACATTTAGAGAGGGG + Intronic
992907706 5:81362553-81362575 CAATCCCATTCCTTTGCGAGGGG - Intronic
998602559 5:143599812-143599834 CAAAACAATTCGTTTCAGAGTGG + Intergenic
1000138638 5:158380263-158380285 CAAACGTCTCCCTTTCAGAGTGG - Intergenic
1000505881 5:162117041-162117063 CAAAACAATCTCTTTTTGAGAGG - Intronic
1002716402 5:181230903-181230925 CAAGTCACTCCCTGTGAGAGTGG - Intronic
1003029082 6:2585644-2585666 CAAAGCATTCCCTCTGAGAACGG - Intergenic
1008286288 6:49655215-49655237 CAAACCAGTCACTCTGGGAGAGG - Intergenic
1008991243 6:57604542-57604564 CAAACCATTCCCCTTGAGAATGG - Intronic
1009179770 6:60502779-60502801 CAAACCATTCCCCTTGAGAATGG - Intergenic
1012501979 6:99898077-99898099 CAAATCAATCCCTGTGATTGTGG - Intergenic
1013280869 6:108635834-108635856 CAGCCCAATCCCTCTGACAGAGG - Intronic
1013628343 6:111959798-111959820 GACACCAACCCCTTTAAGAGTGG + Intergenic
1014888677 6:126814678-126814700 CAAAGCAAATCCTATGAGAGTGG - Intergenic
1017792398 6:157812738-157812760 CCAACCAATATCTTTGGGAGTGG + Intronic
1018618698 6:165710487-165710509 CAAACTGATCCCTTTTAAAGAGG + Intronic
1023270002 7:38452115-38452137 CAAACAAATCCATCTGAGACTGG + Intronic
1024761165 7:52597854-52597876 CAAACCCAACCATTGGAGAGAGG - Intergenic
1026797774 7:73377249-73377271 CACACCAATACGTTTGGGAGGGG + Intergenic
1030892606 7:115017875-115017897 CAAACCTAGCCTTTTAAGAGAGG + Exonic
1031038640 7:116815364-116815386 CAAAGCAGTTCCTTTGAGAAAGG + Intronic
1031121099 7:117723449-117723471 CAAAACAAATACTTTGAGAGAGG + Intronic
1033145279 7:138865864-138865886 CCCACAAATTCCTTTGAGAGAGG + Intronic
1037089580 8:14897213-14897235 CCAACCATTTCCTTTGAGACAGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1038795317 8:30704318-30704340 CACACCAGTCTTTTTGAGAGAGG - Intronic
1040409072 8:47136459-47136481 CAAAACAATCCCATTGAAAATGG - Intergenic
1041202829 8:55467447-55467469 CAATCCACTCCCCTTGAGTGAGG - Intronic
1041895867 8:62924168-62924190 CATACCCAGGCCTTTGAGAGAGG + Intronic
1043247249 8:78020323-78020345 CAAACCACTCCATTAAAGAGTGG - Intergenic
1045254018 8:100504095-100504117 AAATCCACTCTCTTTGAGAGTGG + Intergenic
1045555870 8:103213887-103213909 CAAACCAATCACTGTGACAATGG + Intronic
1046681343 8:117173690-117173712 CAAACCAAACCCATTGACATAGG - Exonic
1046699312 8:117382273-117382295 TCAACCCATCCCTTTTAGAGAGG - Intergenic
1048988122 8:139746291-139746313 CAACTCACTCCCTTGGAGAGGGG - Intronic
1049495159 8:142926673-142926695 CTTGCCAATCACTTTGAGAGGGG + Intergenic
1050361388 9:4834536-4834558 CAAACCAAAGCCCTTGAGAGAGG - Intronic
1055490027 9:76795377-76795399 CAGACCCCTGCCTTTGAGAGGGG + Intronic
1056086774 9:83157378-83157400 CAAACCAACTCCTGTGATAGTGG - Intergenic
1056103206 9:83320231-83320253 CAAAGCATTCCCTCTGAGAACGG - Intronic
1058248217 9:102657592-102657614 CAAACCTTTAACTTTGAGAGAGG + Intergenic
1062669672 9:137700575-137700597 CAAATCAAACCTTTTGAGAAAGG - Intronic
1187025053 X:15426145-15426167 CAGACCAAGACCTTTAAGAGGGG - Intronic
1187162749 X:16779871-16779893 CAAACCACTGCCTTGAAGAGTGG + Intergenic
1188045551 X:25422432-25422454 GAAAGCATTCCCTTTGAGAATGG - Intergenic
1188249053 X:27869305-27869327 CACATAAATCACTTTGAGAGTGG - Intergenic
1189164781 X:38850053-38850075 CTAACCAATACATTTGAGAGTGG + Intergenic
1192377787 X:70581677-70581699 CACACCCATCCCTTTTAAAGAGG - Intronic
1196036738 X:111153623-111153645 CAGACCAATGCCTTTTATAGTGG + Intronic
1201904425 Y:19075655-19075677 CAGCACAATCCCTCTGAGAGGGG + Intergenic