ID: 962412209

View in Genome Browser
Species Human (GRCh38)
Location 3:135151243-135151265
Sequence TCTACCCTGAGCAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962412209_962412214 6 Left 962412209 3:135151243-135151265 CCCTCCAGCTTGCTCAGGGTAGA 0: 1
1: 0
2: 0
3: 18
4: 155
Right 962412214 3:135151272-135151294 ACTCCTTCTAGTGTCCCTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 143
962412209_962412218 21 Left 962412209 3:135151243-135151265 CCCTCCAGCTTGCTCAGGGTAGA 0: 1
1: 0
2: 0
3: 18
4: 155
Right 962412218 3:135151287-135151309 CCTCAGGGTCCTGCCCCCTGTGG 0: 1
1: 0
2: 3
3: 37
4: 366
962412209_962412213 5 Left 962412209 3:135151243-135151265 CCCTCCAGCTTGCTCAGGGTAGA 0: 1
1: 0
2: 0
3: 18
4: 155
Right 962412213 3:135151271-135151293 AACTCCTTCTAGTGTCCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962412209 Original CRISPR TCTACCCTGAGCAAGCTGGA GGG (reversed) Intronic
902929295 1:19719191-19719213 TCTGCCTTGGGCTAGCTGGAAGG - Intronic
903028372 1:20445273-20445295 TCTGGCCTGTGCAGGCTGGAGGG + Intergenic
903885757 1:26540115-26540137 TCTCCCCTGGGCAGGCTGAAGGG - Intronic
906532694 1:46532685-46532707 CCTACTTTCAGCAAGCTGGATGG + Intergenic
908873695 1:68645454-68645476 TCTACCTTCAGCAGGGTGGATGG + Intergenic
909666701 1:78142277-78142299 TCTACTGTGAGAAAGCTGGAAGG + Intergenic
910364678 1:86452143-86452165 TCTAAAATGAGCAAGCTGGGAGG - Intronic
914756233 1:150562946-150562968 TTTACCCTGGGGAAGCTGGGAGG - Intergenic
914901813 1:151715171-151715193 TCTTCCCTGTGCCAGGTGGAGGG + Intronic
916248583 1:162712654-162712676 TCTTCCCTAGCCAAGCTGGATGG - Intronic
916501354 1:165390155-165390177 TCTGCCTTGGGCAAGGTGGAGGG + Intergenic
920957310 1:210631339-210631361 TCTCCACTGAGCAAGTTGGGAGG + Intronic
923628773 1:235635939-235635961 TCCACCTTGAGGAAGCTGAAGGG + Intronic
1067036005 10:42917580-42917602 TCTACCCTCACCAATGTGGATGG - Intergenic
1068814009 10:61289359-61289381 TCTTCCCTAAGTAAGCAGGAAGG - Intergenic
1070692118 10:78534616-78534638 TCTCCCCTGAGCAGGCTGCTTGG + Intergenic
1073082852 10:100871008-100871030 TCTCCCCTGTGCCAGCTGGGGGG + Intergenic
1075881852 10:125859345-125859367 TCTGGCCTGAGCCTGCTGGAGGG + Intronic
1077196561 11:1283898-1283920 TCCAGCCTCAGGAAGCTGGAGGG + Intronic
1077352573 11:2099725-2099747 TCTGCCCTGTGCCAGCTGGCAGG - Intergenic
1078708141 11:13764829-13764851 TCCAGCGTGAGCAAGCTGGGTGG - Intergenic
1079311016 11:19366142-19366164 TCTCCCCTGAGCCAGCATGATGG + Intronic
1080685847 11:34514047-34514069 TTTCCTCTGTGCAAGCTGGAGGG + Intergenic
1081774376 11:45667298-45667320 TCCACCCCCATCAAGCTGGAGGG + Intergenic
1081808307 11:45901752-45901774 GCTTCCCTGAGCAAGGCGGAGGG + Intronic
1083155374 11:60819671-60819693 TCTGACCTGAGCCAACTGGAGGG + Intergenic
1084185020 11:67466978-67467000 TCTACTCTGGGCAAGGTGCAGGG - Intronic
1090277061 11:125427731-125427753 TTTAGCCTGAGGATGCTGGATGG + Intronic
1091948038 12:4566473-4566495 TCTACCCTGCTCAAGCGTGAAGG + Intronic
1092554078 12:9537165-9537187 TCTAATCTGAGCATGTTGGAAGG + Intergenic
1094518021 12:31153464-31153486 TCTAATCTGAGCATGTTGGAAGG - Intergenic
1096513446 12:52144350-52144372 TGTGCCCTCAGGAAGCTGGAGGG + Intergenic
1096553508 12:52389592-52389614 TCAACCCTGATCAGGCTGGGTGG + Intergenic
1096798264 12:54092004-54092026 TCTTCCCAGAGCAAGGAGGAAGG - Intergenic
1104066527 12:125311419-125311441 TTCAACCTGAGCAAACTGGAAGG - Intronic
1104110166 12:125697266-125697288 TCTACCATGAGACAGCTGTAGGG - Intergenic
1111623799 13:90757351-90757373 TCTACAATCTGCAAGCTGGAGGG - Intergenic
1116053249 14:39831340-39831362 TGTACCCTGAGCTACCAGGATGG - Intergenic
1120339195 14:83197287-83197309 TCTACCCTGTGTAAGCAGAAGGG - Intergenic
1121259831 14:92557991-92558013 GCTCTCCAGAGCAAGCTGGATGG + Intronic
1121906963 14:97754953-97754975 TCTGCCCTGGGCATGCAGGAAGG - Intronic
1122609631 14:102973108-102973130 AAGACCCTGAGCAAGCTGGCAGG + Intronic
1124810905 15:32937109-32937131 TCTGCCCTGAGCAAGGGTGAGGG + Intronic
1125740267 15:41957912-41957934 TCCACACACAGCAAGCTGGAAGG + Intronic
1127813514 15:62585481-62585503 GCTTCCCTGAGCAAGTAGGAAGG + Intronic
1128070071 15:64789991-64790013 GCAACCCTGAGAGAGCTGGAGGG - Intergenic
1129170241 15:73803125-73803147 TTTACCCTGGGCAATCAGGAAGG - Intergenic
1129244665 15:74272027-74272049 TCTCCTGAGAGCAAGCTGGAGGG + Intronic
1130905927 15:88240938-88240960 TGTGCCCTCAGCAAGCTGGGAGG + Intronic
1132728325 16:1348384-1348406 TCTGCGCTGAGGAGGCTGGAAGG + Exonic
1134315360 16:13113880-13113902 TCTGCCCTGAGCTGGCTGGCAGG + Intronic
1136514129 16:30757497-30757519 TTTACCCGGAGGTAGCTGGAAGG + Exonic
1137352769 16:47728318-47728340 TCTAGGCTGACCAAGCTGGATGG - Intergenic
1141894958 16:86953522-86953544 TTTACCCTAATGAAGCTGGAGGG - Intergenic
1142751279 17:1989441-1989463 TCTACTGCGAGCACGCTGGAGGG + Intronic
1144842410 17:18195666-18195688 TCCAGCCTGAGCAAGATGGGTGG - Intronic
1146638228 17:34521568-34521590 CCTGCCCTGAGCAAGCAGGCGGG - Intergenic
1147570960 17:41570785-41570807 TCTACCCAGAGCAACCCTGAGGG + Intronic
1147914490 17:43878451-43878473 TCGACCCAGTGGAAGCTGGATGG + Intronic
1147945346 17:44077464-44077486 TCTCCCCGCAGCATGCTGGATGG + Exonic
1147946832 17:44085076-44085098 TGCACCCTGAGCATGCTGGCCGG - Exonic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1149620383 17:58040359-58040381 TCTACCCTGAGCTGGGTTGAAGG - Intergenic
1151325730 17:73378937-73378959 CCTGCCCTCAGGAAGCTGGAGGG + Intronic
1153769387 18:8403012-8403034 TCTAAATTGAGAAAGCTGGAAGG + Intronic
1154048741 18:10933032-10933054 TCTAGGCTGAGCAAACAGGAGGG + Intronic
1156202390 18:34849094-34849116 ACTACCATGAGCAAGATGGAGGG + Intronic
1156269731 18:35519734-35519756 TCTCCCTTGTGCTAGCTGGAAGG + Intergenic
1157325282 18:46664513-46664535 TCTGGCCTGAGGAAGCTGAAGGG - Intergenic
1158524220 18:58197877-58197899 TCTCCCCTGAGCCTGCTTGAGGG + Intronic
1162118256 19:8445231-8445253 GCTACCCTGAGCAGGCGGTACGG - Intronic
1167070813 19:47221233-47221255 TCTTCCCTGAGCCAGCCGGCGGG - Exonic
1168156808 19:54478180-54478202 ACTACCCTGAGTGAGCTGGAAGG - Intergenic
1168638469 19:58014364-58014386 TCTTAGCTGAGAAAGCTGGATGG - Intergenic
927786292 2:25977493-25977515 TCTACTCCCAGCAAGCTGCAGGG + Intronic
927945306 2:27131938-27131960 TCTACCCTGAGTTTGCAGGAAGG - Intronic
930032009 2:47064101-47064123 TCTACCCAGACCAGGCAGGAAGG + Intronic
931433945 2:62231346-62231368 GCAACCCAGAGCAACCTGGAAGG - Intergenic
931614795 2:64144597-64144619 TCTGCACTGAGCATGCTCGAGGG + Intergenic
931889502 2:66655556-66655578 TCAACCCTGTGTAAGATGGAGGG - Intergenic
932322150 2:70830235-70830257 TTTATTCTGAGGAAGCTGGAAGG + Exonic
935189099 2:100761605-100761627 GCTACCCTGAGCAAACTTGAGGG + Intergenic
936530020 2:113269529-113269551 TCAACACTGAGCAAGGTAGAAGG - Intronic
937438048 2:121895588-121895610 TCTACCCGGAGCCAGCTTCATGG - Intergenic
937633262 2:124127051-124127073 TCTGGCCGGAGCAATCTGGAAGG + Intronic
938118799 2:128619836-128619858 TCTACCCTCAGCAAGGAGGCAGG + Intergenic
941670099 2:168283946-168283968 TCTACCATGCTCAAGCTGGAGGG + Intergenic
942088503 2:172464922-172464944 TCTACCCTAATAAAACTGGAGGG + Intronic
945516104 2:210764799-210764821 CCTACCTTGAGCCAGCTGTATGG - Intergenic
945956719 2:216093209-216093231 TCTACCCAGAGGAAACTGAATGG - Intronic
948491085 2:238313839-238313861 TCTGCCTTGTGCAAGCTGGACGG - Intergenic
948886964 2:240889349-240889371 TCAACACTGAGCCAGGTGGAGGG + Intronic
1169276310 20:4235806-4235828 TGCACCCTGAGCACGCTGGAGGG - Intronic
1171003275 20:21436258-21436280 TCTACACTGAGGCAGCTGGATGG + Intergenic
1171358891 20:24572696-24572718 CCCTCCCAGAGCAAGCTGGATGG + Intronic
1171798143 20:29582337-29582359 TCTTCCCAGAGCAAGGAGGAAGG + Intergenic
1171850095 20:30301824-30301846 TCTTCCCAGAGCAAGGAGGAAGG - Intergenic
1172099416 20:32476280-32476302 TCTCCCCTGTGCTAACTGGATGG + Intronic
1176301817 21:5102213-5102235 GCCACCCTGGGCAAGCGGGAGGG - Intergenic
1179855214 21:44159687-44159709 GCCACCCTGGGCAAGCGGGAGGG + Intergenic
1181849645 22:25740981-25741003 TCTACCCTTTGCTAGCTGCATGG + Intergenic
1182121437 22:27789862-27789884 TCTAGGCTGAGAAAGCTGGTGGG - Intronic
1182663025 22:31938438-31938460 GCTCCTCTGAACAAGCTGGAGGG + Intronic
1184345202 22:43908894-43908916 TCTATCCTGAGCATGGTGGAGGG - Intergenic
949771113 3:7579119-7579141 TGAACCCTGAGCAAGCCAGAGGG + Exonic
950570108 3:13794594-13794616 TCTGCCCTCAGCAAGCTCGAAGG + Intergenic
952219829 3:31313832-31313854 TCCACCCTGAACAATCTGGGGGG - Intergenic
952428196 3:33196759-33196781 ACTATCCTGAGCAAACTGGAAGG + Intronic
953388775 3:42522672-42522694 CCCACCCTGAGACAGCTGGAAGG - Intronic
960513597 3:118578792-118578814 TCTTCCCTGAGCTAGATGGATGG - Intergenic
960906125 3:122603333-122603355 TCTTCCTTGAGTAAGCTGGGTGG - Intronic
962412209 3:135151243-135151265 TCTACCCTGAGCAAGCTGGAGGG - Intronic
963512358 3:146263602-146263624 TCTACCCTGAGCTATCTGTTTGG + Intergenic
964358667 3:155871633-155871655 TCGACAGGGAGCAAGCTGGACGG - Intronic
964612036 3:158625162-158625184 CCTGCCATGAGCAAGGTGGAGGG + Intergenic
966925795 3:184643831-184643853 CCCACCTGGAGCAAGCTGGAAGG + Intronic
967904480 3:194488541-194488563 TCTTGCCTGAGCAAGGTGAAGGG - Intronic
967971971 3:195005909-195005931 TCCATCCTGAGTCAGCTGGAAGG + Intergenic
969425375 4:7121117-7121139 TCTACCAGGAGGAAGCTGCAGGG - Intergenic
970015993 4:11513289-11513311 TCTACCCTCAGCAACAAGGAAGG + Intergenic
970431748 4:15995140-15995162 TCTACCCTGAGTATGGGGGATGG + Intronic
971142907 4:23944409-23944431 TCTGCCCTAATGAAGCTGGAGGG - Intergenic
971361573 4:25942892-25942914 TTTACCCTGAGGAAGCTTGCAGG + Intergenic
973856297 4:55013684-55013706 TCTGGCCTGAAGAAGCTGGATGG + Intergenic
976992641 4:91386659-91386681 TCTAGACTGGGGAAGCTGGACGG + Intronic
977211881 4:94227597-94227619 TTTGGCCTGAGCAAACTGGAAGG + Intronic
978137883 4:105284742-105284764 TGTTCCCTGAGCAATCAGGAAGG - Intergenic
996234743 5:121111591-121111613 TATACCCTGAGGAAGATGGCAGG - Intergenic
997944585 5:138188574-138188596 TCTACCCTGAGCTGGCAGTAGGG - Exonic
998005913 5:138656991-138657013 TCTAACCTGAGCCAGCAGGAGGG - Intronic
998474428 5:142408643-142408665 TCAACTCTGACCAAGCTGGAAGG + Intergenic
999023560 5:148198574-148198596 TCAAGCCTGAGCAATCTTGAGGG + Intergenic
999255728 5:150209191-150209213 TCTACCACTTGCAAGCTGGATGG - Intronic
999824913 5:155264716-155264738 TCTTTCCTGAGCAATCTGAAAGG - Intergenic
1002914478 6:1518056-1518078 ACTGCCCTGGGCAAGCTAGAAGG - Intergenic
1004815994 6:19312309-19312331 TCAGCCCTGAGCCAGGTGGAAGG - Intergenic
1006480051 6:34285092-34285114 TCTAGGCTGAGCCATCTGGAAGG - Exonic
1007924553 6:45640897-45640919 TCTCCCAGGAGCAAGGTGGAGGG + Intronic
1018569406 6:165193050-165193072 TCTACCCTGAGCAATGAGGATGG + Intergenic
1019482164 7:1271957-1271979 TCTTCCCTTTGCACGCTGGACGG + Intergenic
1022418532 7:30198669-30198691 TATACCCTGATGAAGCTAGAAGG - Intergenic
1022624770 7:32023981-32024003 TGAACCCTGAGGGAGCTGGAAGG + Intronic
1022954315 7:35367177-35367199 TATACCTTGAACTAGCTGGAAGG - Intergenic
1023837969 7:44079611-44079633 ACAACCCTGAGCCAGCTGCAGGG - Exonic
1024533293 7:50410434-50410456 TCTACCCACAGGAAGCTGGAGGG - Intergenic
1024569009 7:50709151-50709173 TCTGCCCTGATCTTGCTGGATGG - Intronic
1027144321 7:75683511-75683533 TGCACCCTGGGGAAGCTGGAGGG + Intronic
1035300969 7:157896943-157896965 TCTGCCCTGAGAGGGCTGGAGGG - Intronic
1035460490 7:159035605-159035627 TTTACCCGGAGCAAAGTGGAAGG - Intronic
1035529209 8:337796-337818 TCTGCACGGAGCAAGCTGGTCGG - Intergenic
1036473212 8:9069442-9069464 TCTTCCCTGACAATGCTGGATGG + Intronic
1041434880 8:57827871-57827893 TTTACCCTGAACAATGTGGAAGG + Intergenic
1042656305 8:71101465-71101487 TCTACACTAAGCAAGGTGGGTGG - Intergenic
1044398566 8:91743207-91743229 TCTACCCTCAGTAAGCCTGAAGG - Intergenic
1047974483 8:130115721-130115743 TTTAGCCTGGGAAAGCTGGAAGG + Exonic
1048912534 8:139149768-139149790 TCTACCCTTAGTTATCTGGAGGG - Intergenic
1049159065 8:141085857-141085879 TCTGCCATTAGCAAGCTGTAAGG + Intergenic
1049797744 8:144504279-144504301 TCTACCCAGACCAGGCGGGAAGG - Exonic
1052523206 9:29577726-29577748 TCTTTCCTGAGCACGCAGGAAGG - Intergenic
1053787870 9:41665117-41665139 TCTTCCCAGAGCAAGGAGGAAGG - Intergenic
1054157259 9:61649650-61649672 TCTTCCCAGAGCAAGGAGGAAGG + Intergenic
1054176146 9:61876459-61876481 TCTTCCCAGAGCAAGGAGGAAGG - Intergenic
1054477033 9:65580655-65580677 TCTTCCCAGAGCAAGGAGGAAGG + Intergenic
1054661393 9:67704349-67704371 TCTTCCCAGAGCAAGGAGGAAGG + Intergenic
1056238204 9:84617039-84617061 TCTGCCCTGAGCAGACTGGAGGG - Intergenic
1057304205 9:93903038-93903060 GCTACCCTGAGCCAGTGGGAAGG - Intergenic
1057503365 9:95613317-95613339 TATACCCAAAGCAGGCTGGAGGG - Intergenic
1058115884 9:101083672-101083694 TCTACACTGAGGATGCTGCATGG - Intronic
1060207789 9:121692836-121692858 TCTACCCTCAGCAGGCTGCCGGG - Intronic
1186517456 X:10176604-10176626 TCTACCCTGCCCACGCTGGCAGG + Intronic
1186782825 X:12930402-12930424 TCTACCCTTTGCACACTGGAGGG - Intergenic
1187213131 X:17249240-17249262 TCTACCCTGGGCAAGTAGGCAGG + Intergenic
1188972953 X:36639498-36639520 ACTGCCCTTTGCAAGCTGGAAGG - Intergenic
1198125560 X:133640332-133640354 TCCACACTGAGACAGCTGGAGGG - Intronic