ID: 962417578

View in Genome Browser
Species Human (GRCh38)
Location 3:135197152-135197174
Sequence AAGCTGTGACCAGTATCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962417578 Original CRISPR AAGCTGTGACCAGTATCCCA TGG Intronic
900896722 1:5487761-5487783 AGGCTGTGCCCAGTAGCACACGG + Intergenic
902335122 1:15750167-15750189 AGGCTGGGACCAGTTCCCCAAGG + Intergenic
902766107 1:18616534-18616556 AACCTGGGAGCAGAATCCCATGG + Intergenic
903341152 1:22655306-22655328 AAGCTGTCACCAGCATTCCCTGG + Intronic
904039833 1:27577387-27577409 AAGCTGGGACCAGAGTCCTAAGG + Intronic
904473232 1:30748566-30748588 AAGCTCTGACCAGAAGCACAGGG - Intronic
904869427 1:33607460-33607482 AAGCTCTGACCACTCTCCCCAGG - Intronic
907983985 1:59512387-59512409 AAGCTGCGACCGCAATCCCAGGG - Exonic
913209862 1:116573091-116573113 ATGCTGTGACTAGTATTGCAAGG + Intergenic
914334875 1:146704967-146704989 AACCTGTGGGCAGAATCCCATGG - Intergenic
914725887 1:150327470-150327492 AAAATGGGACCCGTATCCCAAGG - Intronic
914938191 1:151999096-151999118 AAGCTGTGCCCTGTACCACATGG + Intergenic
915970471 1:160351603-160351625 AATCTCTGACCAGTGCCCCACGG - Intronic
916578812 1:166089783-166089805 CAGATGTCACCAGTATCCCTTGG + Intronic
917139055 1:171816436-171816458 AAGCTGTCTCCAGAATTCCATGG - Intergenic
917533232 1:175855582-175855604 TAGCTGTGACCTGTTTTCCAAGG + Intergenic
921646124 1:217620293-217620315 AAGCAGTGACCAGTCTCCCACGG + Exonic
923567089 1:235084339-235084361 CAGCTGTGACCAGCACACCAGGG + Intergenic
924286805 1:242495448-242495470 GAGCTGTAAGCAGTATCCCAGGG + Intronic
924860620 1:247916902-247916924 AAGCTGGAGCCAGGATCCCAAGG + Intergenic
1064582603 10:16809463-16809485 GAGCTGTGTCCAGCCTCCCAGGG + Intronic
1066985371 10:42461505-42461527 AACCTCTGACCAGTATCTAAAGG - Intergenic
1067170777 10:43904269-43904291 AAGCTGTGAACAGAGTCCCCAGG + Intergenic
1068882651 10:62066580-62066602 AAGCTGTGTGCAGTAGGCCAGGG - Intronic
1071093443 10:81946668-81946690 AACCTGTGAGCATAATCCCATGG - Intronic
1074199395 10:111221267-111221289 AAGCTCTGCCCTGTATCCCAGGG - Intergenic
1075518808 10:123131761-123131783 TGGCTGTGACCTGTCTCCCAGGG + Intergenic
1076324800 10:129612911-129612933 CAGCTGTGACCAGAAGCACATGG - Intronic
1077143392 11:1034648-1034670 GAGCTGTGACCGGTCTCCCCTGG + Intronic
1077599911 11:3567242-3567264 CAGGTGTAACCAGAATCCCAGGG - Intergenic
1078020431 11:7652206-7652228 CAGCTTTGACCAAGATCCCACGG - Intronic
1081102301 11:39019713-39019735 AAGCTGACACCAGTAACCAATGG - Intergenic
1081670670 11:44940615-44940637 AAGCTGTTACACGTACCCCAGGG - Exonic
1083265520 11:61545066-61545088 GAGCTGTGACCAGTCTCCCTTGG - Intronic
1084816937 11:71653466-71653488 CAGGTGTAACCAGAATCCCAGGG + Intergenic
1087624770 11:100583982-100584004 AAGCAGTGTCCAGCATCCCTAGG - Intergenic
1092112888 12:5976458-5976480 AAGCTATGACCAGTCTCTCAGGG + Intronic
1097065440 12:56317089-56317111 AAGCTTTGTCCAGGATCCAAAGG + Exonic
1097974429 12:65669301-65669323 AAGCTGTAGCCAGATTCCCAAGG + Intergenic
1098177796 12:67811030-67811052 AAGAGGTGCCCAGTATTCCAAGG + Intergenic
1104019753 12:124984035-124984057 AGGCTGTTAACAGCATCCCATGG + Intronic
1107378064 13:39825979-39826001 AAGCTGTGTCCTGGAACCCAAGG - Intergenic
1113351150 13:109530515-109530537 AAGCTGTGAACTGGATACCATGG + Intergenic
1116526856 14:45916426-45916448 ATGTGGTAACCAGTATCCCAAGG + Intergenic
1120937175 14:89908921-89908943 AAGCTGGCACCAAAATCCCAGGG + Intronic
1122864497 14:104597356-104597378 AAGGTGTGACCTGCAGCCCAGGG - Intronic
1126273470 15:46848671-46848693 AAGCAGTGTCCTGCATCCCAGGG - Intergenic
1127626972 15:60789190-60789212 CAGCTGAGGCCAGGATCCCAAGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1131227534 15:90637752-90637774 AAACTGTGACCAGAATCTCCTGG + Intronic
1139284631 16:65799833-65799855 AAACTGTGACCAGTATTCCAGGG - Intergenic
1139476661 16:67206235-67206257 AAACTGTGGCCATTAACCCATGG - Intergenic
1139998748 16:71006269-71006291 AACCTGTGGGCAGAATCCCATGG + Intronic
1141616248 16:85211266-85211288 AAGCTGAGACCAGTCTCTCCTGG - Intergenic
1142987478 17:3705055-3705077 AAGCAGTGACAAGTCTACCACGG + Intergenic
1143393248 17:6572859-6572881 AGGCAGAGACCAGTAACCCAGGG + Intergenic
1145977486 17:28992751-28992773 AGGCTGTGACCAGGGGCCCAGGG + Intronic
1147870081 17:43581062-43581084 AAGCTGGGACCAGTGAACCAGGG - Intergenic
1152919420 17:83058481-83058503 AGGTTGTGGCCAGTATACCAGGG + Intergenic
1157195779 18:45619226-45619248 AAGCTGAGCCCAGTCTCCCCAGG + Intronic
1157478562 18:48038353-48038375 CAGCTGTGAGCAGGACCCCAAGG + Intronic
1157825752 18:50810649-50810671 AAGCTGTGATCAGAATCACTTGG - Intronic
1158707434 18:59805568-59805590 TGGCTGTGACCAGCAGCCCATGG - Intergenic
1167271724 19:48509990-48510012 ACGCCATGACCAGCATCCCATGG - Intronic
1167663936 19:50812288-50812310 GAGCAGTGAGGAGTATCCCAGGG + Intergenic
1167663947 19:50812348-50812370 GAGCTGTGAGGACTATCCCAGGG + Intergenic
927846571 2:26475358-26475380 AATCTATGACCAGGATTCCATGG - Exonic
928743245 2:34380790-34380812 AAGCTGTGTCCATTCTCCCCTGG + Intergenic
931800949 2:65757062-65757084 ATGCAGGGACCAGTGTCCCAAGG + Intergenic
933402722 2:81819465-81819487 AATCTGTGCCCAGAATCCTAGGG - Intergenic
934166169 2:89296268-89296290 CAGCTGTGAAAAGTCTCCCAAGG + Intergenic
934201106 2:89886188-89886210 CAGCTGTGAAAAGTCTCCCAAGG - Intergenic
936457119 2:112683539-112683561 AAGTAGTGACTGGTATCCCAGGG - Intergenic
936694499 2:114930002-114930024 CAGCAGGGAGCAGTATCCCAGGG + Intronic
937467289 2:122145608-122145630 CAGGTGTGCCCAGTATGCCATGG + Intergenic
937902696 2:127034120-127034142 AGGCGGTGACCAGTAAGCCAAGG - Intergenic
942711101 2:178837442-178837464 AGGCTGGGACCAGCAGCCCAGGG - Exonic
943210346 2:184956431-184956453 TAAGTGTCACCAGTATCCCAAGG + Intergenic
944406919 2:199395151-199395173 AAGGTGTCATCAGTATCCAAAGG - Intronic
947285978 2:228515280-228515302 AATCTGTGACAAATATCACAGGG + Intergenic
947485172 2:230541416-230541438 AATCTGTGATCTGAATCCCATGG + Intronic
947959965 2:234228277-234228299 AATCTGAGACCAGGACCCCATGG - Intergenic
948151291 2:235747114-235747136 AATCTGCGACCAGTGTTCCAGGG + Intronic
948768597 2:240235989-240236011 CAGCTGTGGCCAGGATCCCCAGG - Intergenic
1173013893 20:39207964-39207986 AGGCTGTGTCCAAGATCCCAGGG - Intergenic
1176371394 21:6063920-6063942 CAGCTGTGACCCATGTCCCATGG - Intergenic
1177199715 21:17940573-17940595 AAGCTATTAGCAGAATCCCAGGG - Intronic
1179076108 21:38123284-38123306 AACCTGTTAGGAGTATCCCATGG + Intronic
1179752125 21:43474619-43474641 CAGCTGTGACCCATGTCCCATGG + Intergenic
1180723934 22:17930700-17930722 AAGCTGGGAACTGTCTCCCAGGG + Intronic
1181340701 22:22177339-22177361 AATCTATGACCAGGATCCCCTGG - Intergenic
1183590834 22:38778455-38778477 AAGGTGTGATCAGTATCCTCAGG - Intronic
1184284840 22:43464710-43464732 GAGCTGTGGCCAGAGTCCCAGGG - Intronic
950750716 3:15125911-15125933 CAGGTGTAACCAGAATCCCAGGG + Intergenic
952244072 3:31566161-31566183 AAACTGTTCCCAGTATCTCAGGG - Intronic
957070734 3:75565902-75565924 CAGGTGTAACCAGAATCCCAGGG - Intergenic
958660845 3:97064732-97064754 AAGCACTGACCAGTATCACTTGG - Intronic
958679098 3:97303545-97303567 AAGGTGCTACCAGCATCCCAAGG - Intronic
961283361 3:125780666-125780688 CAGGTGTAACCAGAATCCCAGGG + Intergenic
962023502 3:131525017-131525039 AAAATGTGACCAGTTTCCCAAGG - Intergenic
962417578 3:135197152-135197174 AAGCTGTGACCAGTATCCCATGG + Intronic
965133038 3:164725974-164725996 AAGCTGTGACCAGTCCAACAGGG + Intergenic
967987407 3:195105862-195105884 CAGCTGTCACCAGCATTCCATGG + Intronic
969739622 4:9014854-9014876 TAGGTGTAACCAGAATCCCAGGG + Intergenic
970096686 4:12471610-12471632 AGGGTGTGAGCAGTATCCCTGGG + Intergenic
972074588 4:35070056-35070078 AAGCATTGACCAGTAACACAAGG + Intergenic
982206101 4:152998381-152998403 AAGCAGTGACCAGTGTCTAAAGG - Intergenic
982715707 4:158805290-158805312 AAGATTTGACCTGTATTCCAGGG + Intronic
983279627 4:165664329-165664351 GAGCTGTGCCTGGTATCCCAAGG - Intergenic
986977545 5:13410698-13410720 AAGCTGTGCCCAGCTCCCCAGGG + Intergenic
994804616 5:104428340-104428362 CAGCTGTGACCAGGATGGCATGG - Intergenic
995292997 5:110481864-110481886 TAGCTTTCACCAGAATCCCAGGG - Intronic
997578012 5:134997586-134997608 AAGCAGTGACAAGGATGCCAAGG - Intronic
999084109 5:148871992-148872014 CAGCTGTGGCCAGGATTCCAAGG + Intergenic
1001659053 5:173376792-173376814 AAGTTGGGCCCAGCATCCCATGG - Intergenic
1004290772 6:14364883-14364905 AAGCTGTGACCATTATCGAGGGG + Intergenic
1008723205 6:54383628-54383650 AAGATGTGACCAGCAACCAAGGG + Intronic
1010326296 6:74566562-74566584 AAGCCAAGACCAGTATCCTAAGG - Intergenic
1010619996 6:78062360-78062382 TGGCTGTGACCAGAATCCTAGGG - Intergenic
1016571683 6:145520489-145520511 AATCTGTGATAAGTATTCCAGGG - Intronic
1017401837 6:154073532-154073554 AAGCAGTGAACAGTCTACCAGGG + Intronic
1018127483 6:160695698-160695720 TATCTGAGGCCAGTATCCCATGG + Intergenic
1018149039 6:160921354-160921376 TATCTGAGGCCAGTATCCCATGG - Intergenic
1018631872 6:165828719-165828741 CAGCCGTCACCAGCATCCCAAGG + Intronic
1021828386 7:24576925-24576947 AAGCTGTGACCATTATTACCAGG + Intronic
1027623333 7:80519759-80519781 AAGCTGTGACCTGTCAGCCAAGG + Intronic
1027979064 7:85193973-85193995 AACCTGTGATCAGTATGCCAAGG + Intergenic
1028825284 7:95265409-95265431 AAGCTGGGACCAGAATCCCAAGG + Intronic
1030567260 7:111174124-111174146 AAACTGAGACCAGGGTCCCACGG - Intronic
1032439215 7:131929021-131929043 TAGCTGTGACATGTATCCCATGG + Intergenic
1032841745 7:135719635-135719657 AATCTGTGACCAGAATCACCAGG - Intronic
1035455064 7:159002841-159002863 TAGCAGTGACCAGCATCCCGTGG - Intergenic
1036244666 8:7106064-7106086 CAGGTGTAACCAGAATCCCAGGG + Intergenic
1036897164 8:12645368-12645390 CAGGTGTAACCAGAATCCCAGGG - Intergenic
1037804626 8:22052182-22052204 AAGCTGTGACATGTACCACAAGG - Intronic
1040984895 8:53282995-53283017 AAACTGTGACCAGTAGTCAAAGG - Intergenic
1042721088 8:71827500-71827522 AAGCTGTGACCAGGTTCCATAGG + Intergenic
1046010447 8:108539955-108539977 AAGCTGTGACTTGCTTCCCATGG - Intergenic
1046528012 8:115406191-115406213 AAACTGTAAGCAGTTTCCCAGGG - Intergenic
1047603718 8:126453138-126453160 TAGCTGTGACAAGTATACCATGG - Intergenic
1050222770 9:3413154-3413176 AAGCTGGGACTAGTATCCTTAGG - Intronic
1050718044 9:8552530-8552552 AAGCTGCGAGAAGTCTCCCAGGG - Intronic
1052160000 9:25246281-25246303 CAGCTTTCACCAGTCTCCCAGGG + Intergenic
1052702204 9:31950859-31950881 ATGCAGGGACCAGTGTCCCAAGG + Intergenic
1056432450 9:86541129-86541151 TAGCTCTGACCAGTTTCCCTTGG + Intergenic
1058400279 9:104609168-104609190 AACCAGTGACCAAAATCCCAGGG + Intergenic
1061713001 9:132500300-132500322 AAGCTGGGGCAAGGATCCCATGG - Intronic
1186441915 X:9593874-9593896 AGGGGGTGACCAGGATCCCAAGG - Intronic
1187438447 X:19294436-19294458 AATCTGTCAACAGTTTCCCATGG + Intergenic
1188120892 X:26305803-26305825 AAGCTGGGACCTCTAGCCCATGG + Intergenic
1192103233 X:68287916-68287938 AAGCTCTGACCAGGTTACCACGG - Intronic
1192444645 X:71201687-71201709 AAGCTGTGTCCAGTATGGCCTGG - Intergenic
1193330639 X:80232315-80232337 AAGCTGTGCACAGTAGCCCTGGG + Intergenic
1194572768 X:95573952-95573974 ATGCTGGGAGCAGTGTCCCAAGG - Intergenic
1195195868 X:102497611-102497633 AAGATTTGGCCAGGATCCCATGG + Intergenic
1195495843 X:105532139-105532161 AAGCTGTTGCCCATATCCCATGG - Intronic
1199760653 X:150901807-150901829 AAGCTGTGGCCAGTGTGGCATGG + Intergenic
1201227936 Y:11836053-11836075 AAGCTGTGCCCGGTGTCCCCTGG + Intergenic