ID: 962418146

View in Genome Browser
Species Human (GRCh38)
Location 3:135202408-135202430
Sequence GTACCCTATGGGGGCCGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962418146 Original CRISPR GTACCCTATGGGGGCCGCTG AGG (reversed) Intronic
900106665 1:984311-984333 GTGCCCTCTGGTGGCCGCTAGGG - Intergenic
900243068 1:1625976-1625998 GTGCTGTATGGGGGCCGATGGGG + Intronic
900270300 1:1783612-1783634 GTGCCCTATGGGAGCCTCTCCGG + Intergenic
900550577 1:3252464-3252486 GTGCCCAGTGGGGGCCGCGGTGG + Intronic
902461853 1:16583565-16583587 GGACCCCATGGGGGCAGGTGGGG - Intronic
903732082 1:25503975-25503997 GTGCCCTCTGGTGGCAGCTGGGG - Intergenic
904267773 1:29327400-29327422 CTACCCCATGGAGGCGGCTGGGG - Intergenic
904292770 1:29498345-29498367 GCACCCTTTGGGGGCAGATGAGG + Intergenic
921865275 1:220081814-220081836 ATACCCTATGGGGTCAACTGAGG + Intronic
922177029 1:223204831-223204853 GTGCCCTACTGGGGCCACTGTGG + Intergenic
923098275 1:230792737-230792759 CTACCCTCTAGGGGCCGCAGAGG - Intronic
1063487354 10:6432497-6432519 TTACCATATGGGGACTGCTGAGG + Intronic
1080639171 11:34148817-34148839 GGACACAAAGGGGGCCGCTGAGG + Intergenic
1081699712 11:45145509-45145531 GTACCCTCTGGGGGCCGTCTGGG + Intronic
1083037953 11:59657666-59657688 GGACCCTGGGGGGGCCTCTGAGG + Exonic
1088524429 11:110737788-110737810 GTTCCCTGTGGGGTCAGCTGAGG - Intergenic
1091292659 11:134450516-134450538 GTACCCTGAGGGGGCTTCTGGGG + Intergenic
1100228401 12:92582332-92582354 GTACCATTTGGGGGCTGTTGGGG - Intergenic
1104992697 12:132635077-132635099 GTCCACTATGAGGGCCCCTGTGG + Intronic
1107016857 13:35714542-35714564 GTTCCCAAGGGGGGACGCTGAGG - Intergenic
1108381147 13:49855584-49855606 GTTCCCTATGGGAGCCTCTGAGG - Intergenic
1113925629 13:113940055-113940077 GTAGCCTCTTGGGGCCTCTGAGG - Intergenic
1120036804 14:79706989-79707011 GTACCCTACGGGTGGTGCTGAGG + Intronic
1122541535 14:102500377-102500399 GTACCCCATGGTAGCCTCTGAGG + Exonic
1122654852 14:103251278-103251300 GTTACCTATGGGGGCAACTGGGG - Intergenic
1125519656 15:40340719-40340741 CCACCCTCTGGGGGCAGCTGGGG - Intronic
1129248812 15:74296906-74296928 GTTCCCCATGGGACCCGCTGTGG - Intronic
1132980555 16:2736831-2736853 GGACACTATGGGGGCCCCTGAGG - Intergenic
1134124851 16:11609682-11609704 GTAGCAGATGGGGGCCTCTGAGG - Intronic
1141138385 16:81481552-81481574 GCACCCTCTGGGAGCCGCTCTGG - Intronic
1141459320 16:84168123-84168145 GTACCTTCTGGGGGCCCCAGGGG + Intronic
1142149594 16:88506745-88506767 GGACCCTCTGAGGGGCGCTGGGG + Intronic
1142185543 16:88693191-88693213 GTCCCCCATGGAGGCCTCTGGGG + Intergenic
1142379423 16:89723028-89723050 GTTGCCTATGGGGACCGCTGAGG + Intronic
1144834249 17:18148637-18148659 GGACCCTATGGGACCCTCTGGGG - Intronic
1148441974 17:47716161-47716183 GTACCCTGTGAGGGTCCCTGGGG + Intergenic
1152637555 17:81436309-81436331 GTCCCCTCTGGGGGCAGCTGCGG - Intronic
1161358870 19:3834866-3834888 GTACCCTGCCGGGGCAGCTGGGG + Exonic
1161484060 19:4525297-4525319 GTGCCCTCTGGTGGCTGCTGCGG + Intronic
1162531669 19:11239693-11239715 GCCGCCCATGGGGGCCGCTGAGG - Exonic
1162700913 19:12513930-12513952 CTACCCAATCGGGGGCGCTGGGG - Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1164740526 19:30572359-30572381 GCACCCAAGGGGGGCAGCTGTGG + Intronic
1166294140 19:41880790-41880812 GTTCCCTCTGGGGGTGGCTGGGG + Intronic
1167224813 19:48230738-48230760 GGAGGCTGTGGGGGCCGCTGGGG - Intronic
1168113768 19:54209461-54209483 GTACTCTCTGGGGCCCGCTGGGG + Intronic
926118225 2:10226553-10226575 GCCCGCTATGGGGGCCGCTGTGG - Intergenic
935591814 2:104852141-104852163 GCAACCTTTGGGGGCCGCAGAGG + Intergenic
948006897 2:234617131-234617153 GTACCCTCTGGGTGCCTCTCTGG - Intergenic
1169090673 20:2859786-2859808 GCACCCTATGGGGGCCCCATTGG + Exonic
1169116481 20:3069538-3069560 GCTCCCTATGGGGTCAGCTGTGG - Intergenic
1169712402 20:8579815-8579837 CTTCCCTATGTGGGCCCCTGTGG - Intronic
1173858657 20:46267969-46267991 GTTCCCTGTGGGAGCAGCTGAGG - Intronic
1180841962 22:18963289-18963311 GTTCCCTAGGGGGGCTGCTTAGG - Intergenic
1181059536 22:20275592-20275614 GTTCCCTAGGGGGGCTGCTTAGG + Intronic
1181083738 22:20429860-20429882 GCATCCTAGGGGGGCGGCTGTGG - Intronic
1184088449 22:42279946-42279968 GTGCCCTCTGGGGGCCTCTGGGG + Intronic
953550064 3:43894961-43894983 GTCCCCTATGGGTGTGGCTGGGG - Intergenic
961649771 3:128411514-128411536 GTGCCCTCTGGGGTCCTCTGTGG + Intergenic
962090046 3:132233745-132233767 GTACACTATGGTGACCACTGAGG - Intronic
962418146 3:135202408-135202430 GTACCCTATGGGGGCCGCTGAGG - Intronic
962710007 3:138078254-138078276 GTTCCATCTGGGGGCCTCTGTGG + Intronic
967452359 3:189640391-189640413 GTACCCTATAGAGGCTGATGTGG + Intronic
968045718 3:195623082-195623104 GGACACTATGGGGGTCACTGCGG - Intergenic
968064431 3:195750847-195750869 GGACACTATGGGGGTCACTGCGG - Intronic
968308938 3:197667005-197667027 GGACACTATGGGGGTCACTGCGG + Intergenic
968372765 4:11089-11111 GTCCCCTATGGGCGCGGCGGAGG + Intergenic
969302101 4:6303137-6303159 GAACCCTGTGGGGGCGGCTGTGG + Exonic
969546679 4:7834668-7834690 CTACCCCAAGGGGGCAGCTGAGG + Intronic
969928033 4:10603664-10603686 ATTCCCCGTGGGGGCCGCTGAGG - Intronic
985894345 5:2739875-2739897 GAACCCGATGGGTCCCGCTGCGG + Intergenic
985896666 5:2752935-2752957 GTCACCTATGGGGGGCGCTCAGG + Intronic
986061937 5:4199786-4199808 AGACCCTCTGCGGGCCGCTGAGG - Intergenic
992041326 5:72836221-72836243 GTGCCCTAGTGGGGCCTCTGCGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1012996579 6:105981456-105981478 GTACCCTCTGGGGGCCGGCCCGG + Intergenic
1017068403 6:150550617-150550639 GTACCCCATAGGGGCCGAGGTGG + Intergenic
1019428540 7:988259-988281 GTGCCCTGTGGGGGCAGCCGGGG - Exonic
1019632299 7:2056114-2056136 GTTCCCTGTGGCGCCCGCTGAGG - Intronic
1019777114 7:2918455-2918477 GCACCCTGTGGGGGCAGCAGGGG - Intronic
1029090092 7:98041059-98041081 GCTCCCTATGGAGTCCGCTGAGG + Intergenic
1029972728 7:104805060-104805082 TGAGCCTATGGGGGCCCCTGAGG - Intronic
1032665339 7:134030559-134030581 CCACCTTATGGGGGCTGCTGTGG - Intronic
1039813203 8:41068419-41068441 GTATCTTTTGGGGGCTGCTGAGG - Intergenic
1050099077 9:2099344-2099366 GTAATCTATGGGGGCCTTTGGGG + Intronic
1057116050 9:92523417-92523439 GTACCCTATGGGTGGTGTTGAGG - Intronic
1059586348 9:115611533-115611555 GTACCCCAAGGGGGTAGCTGAGG - Intergenic
1192318418 X:70068738-70068760 AGACCCAATGGGGGCAGCTGGGG - Intergenic
1198712299 X:139518268-139518290 GTACCCTATGGGTGGTGTTGAGG + Intergenic
1198863113 X:141091885-141091907 GTACCCTATGAGGGCCGGGAGGG + Intergenic
1198899577 X:141495502-141495524 GTACCCTATGAGGGCCGGGAGGG - Intergenic