ID: 962418718

View in Genome Browser
Species Human (GRCh38)
Location 3:135208118-135208140
Sequence CCCTGTGGCAAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 1, 2: 4, 3: 45, 4: 432}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962418718 Original CRISPR CCCTGTGGCAAGAGGGAAGA TGG Intronic
900237205 1:1598540-1598562 CCCTGTGGGAATGGGGCAGATGG - Exonic
900595414 1:3478084-3478106 CCCTGGGGCAGGAGGGTACAGGG + Intronic
900791702 1:4684983-4685005 CACTGTGGCAGGAGGAAAAAAGG + Intronic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
900883982 1:5402584-5402606 GCCTGTGGCCAGAGGGGAGCTGG + Intergenic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901843155 1:11966230-11966252 TCCTGTGGGAAGTGGGAAGCAGG - Exonic
902133540 1:14284419-14284441 CCCTGTGGCAGGAGAGAATGTGG + Intergenic
902755404 1:18546116-18546138 CTCTATGGCAAGTGGGAGGAGGG - Intergenic
902974160 1:20076822-20076844 CCCTGTGGAAAGAAGGATCATGG + Intronic
903282623 1:22258591-22258613 CCCTGTGTCTAGAGGAAGGAAGG + Intergenic
904437719 1:30509556-30509578 TACTGTGGCAAGTGGGTAGAGGG + Intergenic
904915202 1:33965217-33965239 CTCTGTGGAAAGTGGGAAGCAGG - Intronic
905180720 1:36164541-36164563 CCCTGTGGCAGGAGGGAGTGTGG + Intronic
905264409 1:36741067-36741089 GCCAGGGGCTAGAGGGAAGAGGG - Intergenic
905282690 1:36859322-36859344 ACCTGTGGCAAGGGAGGAGAAGG - Intronic
905789971 1:40784490-40784512 CCCTGAGGCAGGGGGGTAGAAGG - Intronic
905809917 1:40904674-40904696 CCCTGTCTCAAGAGAAAAGAAGG + Intergenic
905899831 1:41574166-41574188 CTCTGAAGCAAGAAGGAAGAGGG + Intronic
907330054 1:53664891-53664913 CCCTGGGGCAAGAGCACAGATGG + Intronic
908328745 1:63049600-63049622 TCCTGTGGGAAGAGGGATGTGGG + Intergenic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
910566610 1:88650828-88650850 CCCTGTGGCATGAGGTCACAGGG + Intergenic
910668126 1:89746013-89746035 ATCTATGGCCAGAGGGAAGAGGG - Intronic
910894435 1:92053276-92053298 CCCTGTGGGAAGATGGAGGAGGG + Intronic
911038598 1:93574736-93574758 CCCTAGGGCAGGAGGGAAAAAGG + Intronic
911074787 1:93862502-93862524 TTCTGAGGCAAGAGGGAAGGGGG + Intergenic
911731889 1:101300120-101300142 TTCTGAGGCAAGAGGAAAGACGG - Intergenic
912916198 1:113817087-113817109 CCGAGTGGCAAGAAAGAAGATGG + Intronic
912977854 1:114346259-114346281 CCCTGGGCCAGGAGGGAAGGGGG - Intergenic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
913229622 1:116730877-116730899 GCCTGGGGCAAGAAGGAAGAAGG + Intergenic
914675931 1:149907568-149907590 CCCTGTGGGAAGGTGGCAGAGGG - Intronic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
918894123 1:190317471-190317493 CCCTTTGGCAAGAGGGAAGAAGG - Intronic
919805655 1:201379775-201379797 CCCTGTGGCAAGACAGCAGGAGG + Intronic
921151904 1:212409447-212409469 CCCTGTGGTGAGAGGGAATGAGG + Intronic
921211225 1:212900308-212900330 CCCTGCTGCAAGTGGGAACAGGG + Intergenic
921431130 1:215067427-215067449 CTCATTGTCAAGAGGGAAGAGGG + Intronic
921446029 1:215248464-215248486 CCCTGTGAAAGGAGGGAGGAAGG + Intergenic
921797739 1:219367029-219367051 TCCTGGGGCAAGTGGGAAAAGGG - Intergenic
922107012 1:222521318-222521340 CCGTGAGGCTAGAGGCAAGAGGG - Intergenic
923042982 1:230333040-230333062 CCCTGAGGGGAGAGGGAGGAAGG + Exonic
923742109 1:236664406-236664428 CACTGAGGGAGGAGGGAAGATGG - Intergenic
1062816987 10:508114-508136 CTCTGTGGCGTGAGGGAGGAAGG - Intronic
1062884926 10:1009203-1009225 CTCTTTGGCCTGAGGGAAGATGG + Intronic
1062932925 10:1364279-1364301 CCCTGTAGCAGGTGGGAAGGGGG - Intronic
1063384310 10:5606535-5606557 CCCTGTGGCACTGGGTAAGATGG - Intergenic
1064137571 10:12764028-12764050 TCCTGGGGGAGGAGGGAAGACGG - Intronic
1064248891 10:13691734-13691756 CCCTGTGCTAAGGGGGAAGGTGG + Intronic
1065178423 10:23100826-23100848 CACTGTGACAAGATGGAAAAAGG + Intronic
1065178808 10:23104731-23104753 TACCGTGTCAAGAGGGAAGATGG - Intronic
1065373741 10:25016225-25016247 CGCTGCAGAAAGAGGGAAGAGGG - Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1067879335 10:50029967-50029989 CCCTGTGCCAAGGGGAATGAAGG - Intergenic
1067892560 10:50149465-50149487 CCCTGTGCCAAGGGGAATGAAGG + Intergenic
1068600251 10:58949192-58949214 CGCAGTGGCAGGAGGCAAGATGG + Intergenic
1069464044 10:68622265-68622287 CCTTGTCCAAAGAGGGAAGAGGG - Intronic
1069751282 10:70746837-70746859 CCCGGTGGCAAGTGGGCAGAAGG + Intronic
1070720937 10:78756703-78756725 CCCTGTGGCAGCAGGCCAGATGG + Intergenic
1070895653 10:79981670-79981692 GGCTGTGGGAAGAGGGAAGGTGG + Intronic
1071336031 10:84601178-84601200 TCCTGTGGCAAGACGGAAACAGG - Intergenic
1074146251 10:110720017-110720039 TCCTATGGCAAGAGGGGTGAAGG + Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075077928 10:119363682-119363704 GCCTCTGGGAAGAGGGAAGCTGG + Intronic
1075490519 10:122863948-122863970 CCCTGTGGAAAAAGGGACAAGGG + Intronic
1076244035 10:128932384-128932406 CTCCGTGGCAGGAGAGAAGATGG + Intergenic
1076454348 10:130579052-130579074 CCCTATGGCTGGAGGGAAGCAGG - Intergenic
1076698723 10:132259187-132259209 CCCTGGGGCAGGTGGGAAAATGG + Intronic
1077305997 11:1868923-1868945 CCCTGAGGCCAGAGGGAGCATGG + Intronic
1077982523 11:7315030-7315052 CCCTGTGGCATGTGGAGAGAAGG - Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078447367 11:11414438-11414460 CCCTGAGGCAGGAGGTAACATGG - Intronic
1078652827 11:13211877-13211899 CCCTGTGGCAAGGGGAAAATAGG + Intergenic
1080123323 11:28702297-28702319 CCCTGTGCCAGGAAGGAGGATGG - Intergenic
1080787994 11:35493521-35493543 TCCTGTGGCAAGAGGAAGCATGG - Intronic
1080894520 11:36438272-36438294 CCCAGTGGGAGGAGAGAAGAGGG - Intronic
1081525568 11:43925323-43925345 CCTGGTGACAAGAGGGAACATGG + Exonic
1081549183 11:44096210-44096232 CCCTGTGGCTGGCGGGAAGGTGG - Exonic
1081925035 11:46819293-46819315 CCCTATGGCAGCAGGGAATATGG + Intronic
1082576854 11:54817266-54817288 CACTGTGGCAAGAGGAGAAAGGG - Intergenic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083738570 11:64695420-64695442 CACAGTGTCAAGTGGGAAGAAGG + Intronic
1083770636 11:64864912-64864934 CCCTGGGGAAAGAGAGAAAAAGG + Intronic
1083853361 11:65380233-65380255 GTCTGTGCCAAGAGGAAAGAGGG + Intronic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084668622 11:70592210-70592232 CCCTGCGTGCAGAGGGAAGACGG - Intronic
1085478683 11:76804505-76804527 CCCAGTGGCAGGTGGGGAGAAGG - Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086224994 11:84497185-84497207 TCCTATGGGAAGAGGGAGGAAGG - Intronic
1087013942 11:93538387-93538409 CCCTGTGCCACCAGGGAAGAGGG + Intronic
1087586521 11:100128729-100128751 CTCTGAGGCAAGAAGGAACATGG - Intronic
1089505539 11:118959541-118959563 CCCTGAGGCAAGAGGGAGCCTGG - Intergenic
1089650052 11:119907121-119907143 GCCTGTGGCAACAGGCAAGCTGG + Intergenic
1089680969 11:120118712-120118734 GCCTGGGGCAGGAGAGAAGATGG - Intronic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG + Intronic
1090030613 11:123203015-123203037 GCCTGTGGTAGGTGGGAAGACGG - Intergenic
1091239949 11:134045710-134045732 CCCTCTGGGAATAGGCAAGAAGG + Intergenic
1091449705 12:564925-564947 CCCTCCGGCAAGAGGAAAGGTGG - Intronic
1092025059 12:5233091-5233113 CCTCCTTGCAAGAGGGAAGAGGG - Intergenic
1092529048 12:9329106-9329128 CTATGTGGCAAGAAGGAAAACGG - Intergenic
1093553505 12:20443957-20443979 CCCTGTGGCAATATGAGAGAAGG + Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1095445500 12:42278219-42278241 AGCTGAGGCAAGAGGGAATAGGG - Intronic
1096744337 12:53715694-53715716 CCCTCTGGGAGGAGAGAAGAGGG - Intronic
1098219371 12:68252448-68252470 CTCTGTGGAAGGAGGGAAGGAGG + Intronic
1100207179 12:92363493-92363515 CCCTCTGTCGAGATGGAAGATGG + Intergenic
1100237213 12:92672881-92672903 CCCTGTGGCAGGAAGGACCAGGG + Intergenic
1100525120 12:95411757-95411779 CCCTCAGGCAAGAGGAAAGCAGG - Intergenic
1100685606 12:96983618-96983640 CCCTCTGCAAAGCGGGAAGAAGG + Intergenic
1102494786 12:113312051-113312073 CTCTGTGGGAAGAGGGGAGTTGG + Intronic
1103158848 12:118710615-118710637 CCCTGTGGCAGGAGGGAGCATGG - Intergenic
1103398898 12:120629006-120629028 CCATCTGGCAGGAGGGAAGTGGG + Intergenic
1104230139 12:126876736-126876758 CTCTGTAGCAAGAGGGAAGCAGG + Intergenic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1104915973 12:132264720-132264742 CGCTGTGGCCAGAGGAAATAGGG + Intronic
1105522059 13:21140178-21140200 CCCTGAGGTAAGCCGGAAGAGGG - Intergenic
1105820813 13:24079165-24079187 CCCTGAGGCATGTGGGAACACGG + Intronic
1107549552 13:41462102-41462124 CCCTGTGGCAAAAGGGAGGTAGG + Intronic
1108364968 13:49701526-49701548 GCCTGTGGCACCAGGGAACAGGG + Exonic
1110942796 13:81370920-81370942 TCCTGTGGCTATAGGAAAGAAGG + Intergenic
1112217391 13:97447338-97447360 CCCTGTGGGTAGAGTGAAGGGGG - Intronic
1112369325 13:98781491-98781513 CCCTGTGGTGTGAGGGAGGAAGG + Intergenic
1113036627 13:106056956-106056978 CTCTGTGGCAAGAGAAAGGAGGG - Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1114536478 14:23426080-23426102 CCCTGTGGCAAGAAGGAAGTAGG + Exonic
1114654246 14:24306527-24306549 CCCAATGGCAAGAAGCAAGAAGG + Exonic
1115019088 14:28653113-28653135 TCCTGAGGCAAGAGGGAACATGG + Intergenic
1117568596 14:57022566-57022588 TCCTGTGGCAGGAGAGAAGAAGG - Intergenic
1118056165 14:62081741-62081763 CCCTGTGGCAAGCAGGGAAATGG - Intronic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1119768372 14:77205114-77205136 CCCTGTGGCAGGAGGGAAGGTGG + Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121808435 14:96855469-96855491 CACAGTGGCATGAGGAAAGAAGG + Intronic
1122294821 14:100699455-100699477 CCTGGTGGCCAGTGGGAAGAGGG + Intergenic
1122778425 14:104133352-104133374 CCCTGGGGGAAGAGGGAAGGAGG + Intergenic
1122784071 14:104155852-104155874 CCCTGTGGGAAGAGGGTGGAGGG + Intronic
1122847831 14:104510415-104510437 CCCTGGGGCAGGAGGGGAGGGGG - Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123410713 15:20056578-20056600 CCCTGTGGAGTGTGGGAAGAGGG - Intergenic
1123520042 15:21063284-21063306 CCCTGTGGAGTGTGGGAAGAGGG - Intergenic
1124203972 15:27701808-27701830 CCCTGTTGCTGGAGGGAGGAAGG + Intergenic
1124350016 15:28948340-28948362 ACCAGTGGCCAAAGGGAAGAAGG - Intronic
1124411397 15:29440653-29440675 CCCTGTGGTGAGAGGCAGGACGG - Intronic
1124658182 15:31525146-31525168 CCCTGTGGCAGGAGGGAGAGAGG + Intronic
1124700134 15:31905404-31905426 CTCTGCGGCCAGAGGGAACATGG - Intergenic
1125766075 15:42137425-42137447 CGCTGAGGCCAGAGGGAGGAAGG + Intergenic
1126196572 15:45938103-45938125 CCAGGAGGCAATAGGGAAGAGGG + Intergenic
1126667722 15:51090295-51090317 CACTAAGGCAAGATGGAAGAGGG - Intronic
1126800436 15:52293197-52293219 CCCTGTGGGAACAGGGAAGAGGG - Intronic
1127999891 15:64181128-64181150 CTCTCCGACAAGAGGGAAGATGG + Intronic
1128221457 15:65971599-65971621 CCCTGTGGCAGGAGGTTGGAGGG + Intronic
1128290580 15:66475542-66475564 CCCTAAGGCAAGATGGAAGACGG - Intronic
1129191751 15:73941647-73941669 CCCTGAGGCCAGAGAGGAGACGG + Intronic
1129296819 15:74604335-74604357 CCCTGTGGGCAGAGGGGAGGTGG + Intronic
1129682815 15:77667506-77667528 CCCTGGTGCAGGAGGGAAGTGGG + Intronic
1131030683 15:89183937-89183959 GCCTGTGGTCAGAGGGAAGGGGG - Intronic
1131255316 15:90858256-90858278 CCCTGTGGCAGGAGCGTAGTGGG + Intergenic
1131542961 15:93289824-93289846 CTCTGAGGCAAGAGCGAAGGGGG - Intergenic
1131602777 15:93866409-93866431 CTCAGAGGCATGAGGGAAGAAGG + Intergenic
1132214570 15:100053300-100053322 CCCTGAGACAACAGGTAAGACGG + Intronic
1132744641 16:1431597-1431619 GCCTGTGGCAGGAGGGCGGAGGG - Intergenic
1132953053 16:2575611-2575633 CCCTGAGGAAAGAAGGGAGAGGG + Intronic
1132961298 16:2624557-2624579 CCCTGAGGAAAGAAGGGAGAGGG - Intergenic
1133540181 16:6743748-6743770 CCCTGTCTCAAAAGGAAAGAAGG + Intronic
1133877983 16:9752694-9752716 CCTTATGGCAAGAGGGAAAAGGG - Intergenic
1134082938 16:11336686-11336708 GACCGTGGAAAGAGGGAAGAGGG + Intronic
1135098129 16:19581504-19581526 CCCTGTGGGGAGAAGGCAGAAGG - Exonic
1135413354 16:22251130-22251152 TCCTGTGGGAAGAGGCAACAGGG - Exonic
1136001794 16:27300100-27300122 CCCTTTGGCAAGACGGGGGAGGG - Intergenic
1138339168 16:56277336-56277358 GCCTGTGGAAAGAGGGAATGGGG + Intronic
1138505783 16:57477649-57477671 CCCTGTGCGAAGTGGGAAGGAGG - Intronic
1138532697 16:57643449-57643471 CCCTGTGGGAAGAGTGACAAAGG - Intronic
1138923993 16:61568202-61568224 CCCTGTGGCTAGAGGAAACATGG - Intergenic
1139307412 16:65998970-65998992 CTCTGTTGCAAGAGGGAACCTGG + Intergenic
1139490449 16:67283224-67283246 TCCTGTGGCAGGATGGAGGACGG + Intronic
1139591841 16:67937323-67937345 CCCTCTTGAGAGAGGGAAGATGG - Intergenic
1140709586 16:77664416-77664438 CCCTGTGGTACGAGGGAACATGG - Intergenic
1140722892 16:77787346-77787368 CCCTGTGGAAGGAGGGAAAATGG + Intergenic
1142131447 16:88433299-88433321 CACTGTGGAAGGAGGGAAGGTGG + Exonic
1142178668 16:88656732-88656754 CCCTGTGGGAGGAGGGGAGAAGG - Intronic
1142739928 17:1925941-1925963 CCCTGTAGGAAGAAGGATGATGG + Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143970138 17:10789481-10789503 TCCTGTGCCCAGAGAGAAGATGG + Intergenic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144201624 17:12947356-12947378 CCCTGTGGTCAGAGGCCAGAGGG - Intronic
1144234230 17:13241701-13241723 CCCTGTATCAGGAGGGAACAGGG + Intergenic
1144292656 17:13841514-13841536 TCCTGTGGCAGGAGGTAGGATGG - Intergenic
1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG + Intronic
1144795646 17:17889410-17889432 CCCTGTGCCTATAGGGAAGTGGG - Intronic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1147338933 17:39742545-39742567 TCCTGTGGCAAGAAGAAAAAGGG - Exonic
1147633074 17:41945062-41945084 CACTGTGGAAATAGGAAAGAAGG - Intronic
1148113470 17:45161178-45161200 CCCTGTGGAAAGACCGCAGAGGG + Intronic
1148546185 17:48520745-48520767 TTCTGTGGGAAGTGGGAAGATGG + Intergenic
1148761403 17:50003594-50003616 CGGTGAGGCAAGAGGGTAGATGG + Intergenic
1149821754 17:59786688-59786710 CCCTGTGGTTACAGGGAAGCTGG - Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1150584519 17:66505317-66505339 ACCTCTGGCCACAGGGAAGAGGG + Intronic
1150649438 17:67000372-67000394 GCCTGTGGAAGGAGGGAAGCTGG + Intronic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1152328538 17:79657012-79657034 CCCTGTTGGAACAGGGCAGAGGG - Intergenic
1153239365 18:3016441-3016463 TCCTGTTGCAAAAGGGATGATGG - Intergenic
1155064218 18:22254791-22254813 CCACCTGGAAAGAGGGAAGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155649375 18:28121994-28122016 CCATGTGTCAAGAGGGAGAAGGG - Intronic
1157186053 18:45540828-45540850 CCCTGTGCCAGGTGGCAAGAGGG - Intronic
1157192885 18:45596144-45596166 CACTGTGGCAAGATAGGAGAGGG - Intronic
1157565305 18:48675588-48675610 CCCTGCAGCAAGTGGGAGGATGG + Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1159217301 18:65410271-65410293 CACTGTGGCAAGTGAGAAAAAGG + Intergenic
1160131745 18:76231492-76231514 CCCTGAGGCTGGAGGTAAGAAGG - Intergenic
1160373872 18:78396286-78396308 ACCTGGGGCAAGGGGGGAGAGGG + Intergenic
1160399259 18:78597989-78598011 CCCAGTGGCAGGGTGGAAGATGG + Intergenic
1160988684 19:1851887-1851909 CCTAGTGGGAATAGGGAAGAGGG - Intergenic
1161039639 19:2103410-2103432 CCCAGTGGCAGGAGGGCGGAAGG - Intronic
1161546694 19:4885264-4885286 CCCTGCAGCAAGAGGGAGGGAGG + Intergenic
1161546788 19:4885829-4885851 CCCTGCAGCAAGAGGGAGGGAGG + Intergenic
1162100693 19:8336837-8336859 CCCTGGGGTAGGAGGGAGGAGGG + Intronic
1162299319 19:9835326-9835348 CGCTGCGGCAGGAGGGAAGATGG + Exonic
1162309396 19:9896596-9896618 CCCTGGGGTAAGAGGAAGGATGG - Intronic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1163490489 19:17614757-17614779 GCCTGAGGCAACAAGGAAGACGG - Intronic
1164519797 19:28970180-28970202 ACCTGTGGCAGAAGGCAAGAGGG - Intergenic
1164696389 19:30247574-30247596 CACTTTGGGAAGTGGGAAGATGG + Intronic
1164809746 19:31146874-31146896 CCATGTGGCAAGAGCTAAGAGGG - Intergenic
1164870573 19:31640113-31640135 AGCTGTGGCTAGAGGAAAGAAGG + Intergenic
1165216083 19:34273836-34273858 CCAGGTGGCGAGAAGGAAGATGG + Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1166169726 19:41019252-41019274 GCCTGTGGCCAGTGGGAAGCTGG + Intergenic
1166351493 19:42200648-42200670 CACTGTGCCAAGAGGAGAGAAGG + Intronic
1167449826 19:49560549-49560571 ACCTGGGGCACGAGGGGAGAGGG + Intronic
1168271366 19:55251537-55251559 CCCTGTGTCAAGAGTGACGAAGG + Intronic
1168497831 19:56869127-56869149 CCTTCTGACAACAGGGAAGAAGG + Intergenic
926699827 2:15796283-15796305 CCCTGAGGCAGGAGAGAGGATGG + Intergenic
927495393 2:23548586-23548608 CACTGTGGCAAAAGGAGAGATGG - Intronic
928838703 2:35579356-35579378 ACCTGTGGAAAGAGTGAAGGAGG + Intergenic
929884729 2:45868446-45868468 GCCTGTGGCAGGAGGGAAAAAGG - Intronic
932348075 2:71008629-71008651 TCCTGAGACAAGTGGGAAGAAGG - Intergenic
933130978 2:78673716-78673738 CCATCTGGAAAGAGGGAAGCAGG + Intergenic
933439687 2:82297045-82297067 CCCTGTGGCAGGTGCGAGGATGG - Intergenic
933844083 2:86311280-86311302 CCCTGTTGCAGGAGGAAATAAGG - Intronic
933980356 2:87544300-87544322 CCCTGTGGCATCTGGGGAGAAGG + Intergenic
935290315 2:101604655-101604677 CCCTGAGGGATGAGGGATGAGGG - Intergenic
935836178 2:107056798-107056820 CCAAGTGGAAAGAGGGAAGGTGG - Intergenic
936313470 2:111406491-111406513 CCCTGTGGCATCTGGGGAGAAGG - Intergenic
936876237 2:117193050-117193072 CCCTGTGGCAGCAGGGACTAGGG - Intergenic
937257288 2:120564520-120564542 CCCTGTGGCAGGAGGATGGAGGG + Intergenic
938320589 2:130359677-130359699 CCTTGTGGGAGGAGGGAGGAGGG + Intronic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940223753 2:151381131-151381153 ACTTGGGGCAAGAGGGAAGATGG - Intergenic
942314953 2:174689688-174689710 CCCAGTGGAATGAGGGAAAAAGG + Intergenic
942471392 2:176264269-176264291 GCCTGTGACAAGAAGGAAAATGG - Intergenic
943961171 2:194265066-194265088 CCCTGTGCCAAGATGGGAGCAGG - Intergenic
944096350 2:195973102-195973124 CCCAGTGGCAAGAAGGAGCAAGG + Intronic
946404994 2:219487622-219487644 CCCGATGGCAGGTGGGAAGAGGG + Intronic
947824128 2:233092785-233092807 GCCTGTCTCAAGATGGAAGAAGG - Intronic
947861838 2:233366048-233366070 CCCTGTGGCAAGAGGGAGCTTGG + Intronic
948079697 2:235195680-235195702 CCCTGTGGTAAGAGAGCAGTGGG - Intergenic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948728289 2:239947751-239947773 CCAGATGGCAAGAGGGATGAGGG + Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1169007968 20:2224659-2224681 CCCTGTGGCAGGAGGAAATGTGG - Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172274090 20:33670420-33670442 CCCTGTGGGAAGCGGGAATGGGG + Intronic
1173018193 20:39245692-39245714 GCCTGAGGGAAGAGGGAGGAAGG + Intergenic
1173657725 20:44711894-44711916 CTCTGAGGCAAGAAGGAAGACGG - Intergenic
1173947573 20:46963844-46963866 CCCAGTGGCAAGAGGTACTATGG + Intronic
1173949399 20:46978484-46978506 CCCTGTGGCAAGAGGGAGTGTGG + Intronic
1174545983 20:51325537-51325559 CCCTGTGGCGAGCGGGGAGCCGG - Intergenic
1174821853 20:53733326-53733348 TCCTGTGGCAAGAGGCAACCTGG + Intergenic
1174862612 20:54105347-54105369 CCCAGAGGCCAGTGGGAAGATGG - Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175468747 20:59210648-59210670 CCCTGAGGCTGAAGGGAAGAAGG - Intronic
1175724868 20:61310826-61310848 CCCTGTGGGAAGAGGGAGCTAGG - Intronic
1175853615 20:62107109-62107131 TCCCGTGGCAGAAGGGAAGATGG - Intergenic
1175869091 20:62199097-62199119 CCTGGGGGAAAGAGGGAAGACGG - Exonic
1176073320 20:63237778-63237800 CCAGGTGGCAAGAAGGAGGAGGG - Intronic
1176094875 20:63336050-63336072 TCCTGAGGCAAGAGGGGAAAGGG + Intergenic
1176119904 20:63449719-63449741 TCCTGGGAGAAGAGGGAAGAGGG + Intronic
1176309626 21:5142732-5142754 TCCTGTGCCAAGTGGGAAGGTGG - Intronic
1176736513 21:10552787-10552809 CGCTGAGGCAAGAAGGAAAAAGG + Intronic
1178724118 21:35036061-35036083 CCCTGAGGGAAGACAGAAGAGGG + Intronic
1179093774 21:38293218-38293240 CCTTCTGGTAAGTGGGAAGAAGG - Intronic
1179382472 21:40912094-40912116 CCCAGTGGCAAGCAGGCAGATGG - Intergenic
1179847432 21:44119301-44119323 TCCTGTGCCAAGTGGGAAGGTGG + Intronic
1179874551 21:44261504-44261526 CCCTGTTACAACATGGAAGATGG + Intronic
1179911838 21:44455051-44455073 TCCTGATGCCAGAGGGAAGAGGG + Intergenic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1181118603 22:20650213-20650235 CCCTGTGCCAAGGGGAATGAAGG + Intergenic
1181324760 22:22036357-22036379 CCCAGTGGCAGAAGGGAGGAAGG + Intergenic
1183027423 22:35076403-35076425 CCCTGTGCCCACAGGGAACAAGG - Intronic
1183532626 22:38369897-38369919 CGCTGAGGCAAGAAGGAAAAAGG - Intronic
1183677293 22:39306740-39306762 CCCTGGGCCATGGGGGAAGATGG + Intergenic
1184089584 22:42285157-42285179 CCCCGTGGCACCAGGGAAGAGGG - Intronic
1184605593 22:45572741-45572763 CCCTTTGGCAAGATGGTAGGTGG - Intronic
1184726179 22:46347959-46347981 CCCTGTGGCATAAGGAAGGAAGG - Intronic
1185004116 22:48265293-48265315 CCACGTGGCAAGAGGGAGGGAGG + Intergenic
1185035938 22:48476932-48476954 CCCTGTGGCTTGTGGGAAAATGG + Intergenic
1185105189 22:48864956-48864978 ACCTGTCCCAAGAGGGAAGAAGG - Intergenic
951449020 3:22815593-22815615 CCCTGTGGAAATAGGAAGGAGGG - Intergenic
951516496 3:23565634-23565656 CCCTCTGGCTAAAGGGAAGTTGG + Intronic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952305407 3:32141740-32141762 CCCTCTGGGAAGAGGGAAATGGG - Intronic
952882194 3:37991810-37991832 CCCTGAGGAAAGAGGGCAGGAGG + Intronic
952929655 3:38349196-38349218 CCCTGTGGCAAGAAAGAGCATGG + Intronic
953025427 3:39142268-39142290 GCCTTTGGGAAGGGGGAAGATGG + Exonic
953289917 3:41650315-41650337 CCATGTTGCAAGAGACAAGAAGG + Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954130909 3:48560490-48560512 CCCTGTGGCAGGCTGGAAGGAGG - Intronic
954425051 3:50438786-50438808 GCCTAGGGCAAGGGGGAAGATGG + Intronic
954847547 3:53572955-53572977 GCCATGGGCAAGAGGGAAGATGG - Intronic
954870870 3:53766644-53766666 CCCTGTGGGAAGAGGCTCGAGGG + Intronic
954979643 3:54733309-54733331 CCTTGTGCCAAGAGGGCAGCTGG + Intronic
955084836 3:55692641-55692663 GCCTGTAGAAAGAGGGGAGAAGG + Intronic
955341417 3:58128220-58128242 CCATGTGGTAAGGGGGAAGCAGG - Intronic
955891229 3:63652209-63652231 CCCTGGGGCAGGAGGGAATGTGG - Intergenic
955905612 3:63804464-63804486 CCCTGTAGCAAGAAGGAGCATGG - Intergenic
956781338 3:72605748-72605770 CCCTGTGGCAAGAGTGCAAGTGG - Intergenic
959582978 3:108000938-108000960 TTCTGTGTCAAGGGGGAAGAAGG - Intergenic
960573415 3:119206797-119206819 CCCTGGAGCCAGAAGGAAGAGGG - Intergenic
961356906 3:126345044-126345066 GCCTGTGGCAAGAAGGACCAAGG - Intronic
961646818 3:128397184-128397206 TCCTGTGGAAGGAGGGAGGATGG - Intronic
961828786 3:129612679-129612701 CCCCGTGGCAGGAGGGCTGAGGG + Intergenic
962240513 3:133747383-133747405 CCATGGGCCAAGAGGGAAAATGG + Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
962931515 3:140041875-140041897 ACCTGTGTGAGGAGGGAAGAGGG + Intronic
963045907 3:141102579-141102601 CCCTGTGGCAAGAGGGAGGCTGG + Intronic
964805263 3:160602803-160602825 CCCTGTAGCAAAAGGAAAGTGGG - Intergenic
964928906 3:161991574-161991596 CCCTGTGGGAAGAAGGCAGGAGG + Intergenic
966200812 3:177358635-177358657 CCCTGTGGCAAGGTGGGGGAGGG + Intergenic
966559340 3:181302174-181302196 GACTGAGGCAAGAGGGAACATGG + Intergenic
966812191 3:183856583-183856605 CCCAGTGGGAGGATGGAAGATGG - Intronic
966967334 3:185007176-185007198 GCCTGTGGGAAGGAGGAAGAGGG - Intronic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968763726 4:2457436-2457458 CTCTGTGGCAGGAAGGAGGAGGG + Intronic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
969337365 4:6519521-6519543 CCCTGTGGCAGGAGGCAGCATGG - Intronic
973337288 4:48969683-48969705 CCCTGTGGCCAGGGCCAAGAGGG - Intergenic
973555794 4:52081418-52081440 CCCTGAGGCCAGAAGGAGGAGGG - Intronic
973832980 4:54780565-54780587 CCCCGTGGCAAGAAAAAAGATGG - Intergenic
974046327 4:56901768-56901790 TCCTGTCTCAAGAGAGAAGAGGG + Intergenic
976307021 4:83570199-83570221 GCCTGGGGCCAGAGAGAAGAAGG - Intronic
977354982 4:95934077-95934099 TCCTATGGCAGGAGGGCAGAGGG + Intergenic
977397010 4:96484006-96484028 GTCTGTGGAAAGAGGGAAGGAGG - Intergenic
977569280 4:98612814-98612836 CCCTGTGGGGGGAGGGAGGAAGG - Intronic
978264197 4:106803091-106803113 ACATGAGGAAAGAGGGAAGAGGG - Intergenic
978839169 4:113189294-113189316 CTCTGTGGGAAGAGAGAGGAGGG - Intronic
980967837 4:139540432-139540454 CCCTGTTTCAAGTTGGAAGATGG + Intronic
981000977 4:139828964-139828986 CCCTGTTGAAAGAGGAAGGAAGG + Intronic
981056427 4:140366868-140366890 GCGTTTGGCAAGAAGGAAGAAGG + Intronic
981677290 4:147357217-147357239 GACTGTGGAAAGAGGGGAGAGGG - Intergenic
981864955 4:149406456-149406478 TCCTGTGGCAAGAGGGAGCATGG + Intergenic
982268242 4:153559960-153559982 ACCTGTGGCAGGAGGGAAAACGG - Intronic
982455284 4:155602469-155602491 CCCTAAGGCAAGAAGGAAGCTGG - Intergenic
984580269 4:181502705-181502727 CCATAGGGAAAGAGGGAAGAAGG + Intergenic
985031533 4:185795331-185795353 CCCAGTGGCAGGAGAGAGGAAGG - Intronic
986638108 5:9844403-9844425 CCCTGTGGTAAGAAAGAATAGGG - Intergenic
986746699 5:10751093-10751115 CCCTGGGGAAAGGTGGAAGAGGG - Intronic
988200580 5:28063741-28063763 ACCTGTGGCAAGAAGGAAATGGG - Intergenic
989607109 5:43255160-43255182 CTCTGTGGTAACATGGAAGATGG + Intronic
990225665 5:53649504-53649526 CTCTGTGGCAACATGGATGAAGG - Intronic
990370570 5:55114310-55114332 CCCTGTGGCCTGGGGGAAGAAGG + Exonic
991503305 5:67299039-67299061 CCCTTAGACAAGAGGGTAGATGG + Intergenic
992494266 5:77276958-77276980 CCCTGTGTCTAGAGGCAGGAAGG - Intronic
992663791 5:78985775-78985797 GCCTGTGGCAGGTGGGAGGACGG + Exonic
995064119 5:107841017-107841039 CTATGTGGTAAGGGGGAAGATGG + Intergenic
995320239 5:110825399-110825421 CCATGTGGAAAGAGGAAAAAAGG - Intergenic
997510082 5:134448026-134448048 GCCTGTTGCAAGAGGCAAGGTGG - Intergenic
998384131 5:141746588-141746610 CCCTGTGGCAGGAGGTAGCATGG + Intergenic
999661083 5:153863463-153863485 CCCTGTATCAACAGGGAGGAAGG - Intergenic
999844094 5:155459361-155459383 ACCTGTGGAAGGAAGGAAGAAGG - Intergenic
1000168342 5:158677301-158677323 CCTTGGGGCAGGAGGGAGGAAGG - Intergenic
1000507174 5:162135776-162135798 CCCTGTGGGAAGAGGAAGCAGGG + Intronic
1000672404 5:164078742-164078764 CACTGTGGCAGGAGAGAAGCAGG - Intergenic
1000724581 5:164753540-164753562 TCCTAGGGCAAGAGGCAAGAGGG - Intergenic
1001224542 5:169932438-169932460 CCATGTGGCAAGAGAGAGGGAGG + Intronic
1001679511 5:173545911-173545933 CCTTGTGGGAAGAGGGGAGGGGG - Intergenic
1003169437 6:3709528-3709550 CCCTGAGGCAAGAAGGAATCTGG - Intergenic
1003277893 6:4667847-4667869 GTCTGTGGGAAGAGAGAAGAAGG - Intergenic
1003513700 6:6801932-6801954 CCCTCAAGCATGAGGGAAGAAGG + Intergenic
1004123564 6:12850363-12850385 CCCTGGAGCAAGAGTGAAGGAGG - Intronic
1004145513 6:13062381-13062403 CCCTGTGGGAAAGGGGAAGCCGG - Intronic
1004413011 6:15399260-15399282 CCCAGTGGCACTGGGGAAGAAGG - Intronic
1004563333 6:16771940-16771962 CCCTGAGGCAAGAGAGCAGCTGG - Intergenic
1004583763 6:16979558-16979580 CCCTGTGGCAAGCAGGAGCATGG - Intergenic
1006414204 6:33893698-33893720 GTCTGTGGCAAGAGGCAAAAAGG + Intergenic
1007273353 6:40655523-40655545 ACCTGTGTCCAGAGGGAAAAGGG + Intergenic
1007288389 6:40765097-40765119 CCCTGTGGCAGAAGGAAAAAAGG + Intergenic
1007499909 6:42288757-42288779 CTCTGTGGCAGGTGGGAACAAGG + Intronic
1008832980 6:55791741-55791763 ACGTGGAGCAAGAGGGAAGATGG + Intronic
1012250102 6:96970390-96970412 TCCTGTGGCAGGAGGGAGCATGG - Intronic
1013301244 6:108806636-108806658 CCCTGTGGGAAGAGTTCAGAAGG + Intergenic
1013343210 6:109235803-109235825 ACCTGTGGCCAGAGGGATCATGG + Intergenic
1013432206 6:110065086-110065108 TCCTGTGGCAAGAGGGAGTGTGG + Intergenic
1013487071 6:110607327-110607349 CCCCGAGGGAAGAGGGGAGAGGG + Intergenic
1013697669 6:112723424-112723446 CCCTGTGCCAAAAAGAAAGATGG + Intergenic
1014459355 6:121677243-121677265 GCCTGTGCCAAGAGGTAACATGG + Intergenic
1015707654 6:136105782-136105804 CCCTGTGGCCAAATGGATGAAGG - Intronic
1016866312 6:148770847-148770869 CCCTGTGGCATGAGGCGAAAAGG - Intronic
1017201943 6:151763981-151764003 CCCTGTGGGTAAAGGGAAGGAGG + Intronic
1017373219 6:153736989-153737011 CGCTATTGCAAGAGAGAAGACGG + Intergenic
1017823566 6:158065409-158065431 CCCTGTGGAAACAGAGAAGGAGG + Intronic
1019601260 7:1884857-1884879 CCGTGGGGCAAGGGGGCAGAGGG + Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020878200 7:13724994-13725016 CCCTGTGGCACGAGGTACCAGGG + Intergenic
1021352341 7:19610701-19610723 CCCTGGGGGAAGAGTGTAGAGGG - Intergenic
1022306107 7:29147972-29147994 CCCTGTGGGAAGAGAGGAGGTGG - Intronic
1022520951 7:31006600-31006622 CTCTGAGGCAGGAGGGAAAAGGG - Intergenic
1024119288 7:46220857-46220879 CCCTGAGGTGGGAGGGAAGAGGG + Intergenic
1026012139 7:66644757-66644779 CCCTGTGTTAAGGGGGTAGATGG + Intronic
1027199510 7:76054352-76054374 CCCTTGTGCAAGAGGGCAGATGG - Intronic
1029270183 7:99372943-99372965 CCCTGTGGGAAGAGGGCTGCCGG + Intronic
1029619734 7:101682582-101682604 CCCAGTGGCAAGGGGGAAAGAGG - Intergenic
1030298106 7:107948801-107948823 CCCGGTGGCACGAGGGCAGCAGG - Intronic
1030447616 7:109667189-109667211 CCCTGTGATAAAAGGGAACATGG + Intergenic
1031271560 7:119656413-119656435 CCTTGTGACAAGTGGTAAGATGG + Intergenic
1031548237 7:123076798-123076820 CCATGTGATAACAGGGAAGACGG + Intergenic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033415384 7:141157132-141157154 GCCAGTGGGAAGAGGGCAGAAGG - Intronic
1034278298 7:149834002-149834024 TCCTGGGGCTCGAGGGAAGAGGG + Intergenic
1034420869 7:150989957-150989979 CTCTGTGGCCACAGGGAGGATGG - Intergenic
1034934686 7:155191257-155191279 CCCCGTGGCAAGTGGGAGGAAGG - Intergenic
1034940670 7:155228309-155228331 CCCTGAGTCCGGAGGGAAGAAGG + Intergenic
1035797895 8:2376203-2376225 CCTTGTGGCCACAGTGAAGAGGG - Intergenic
1037440502 8:18911191-18911213 CCCTGTGGTTTGAGGAAAGAGGG - Intronic
1037467547 8:19174757-19174779 CCCTGTGGCAACATGGGAGAGGG - Intergenic
1037837674 8:22223877-22223899 CCCTGGGGCCAAAGGGAAGGTGG - Intronic
1038191253 8:25323183-25323205 CCCTGTGGCAGCTGGGAGGAGGG - Intronic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038686392 8:29722585-29722607 CACTGTGGAAAGCTGGAAGAAGG + Intergenic
1039223895 8:35366312-35366334 CCATGTGGCAAGAGAGAAATGGG - Intronic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040724278 8:50362959-50362981 CCCTGTGGGAAGAGAAAGGATGG + Intronic
1040732039 8:50459673-50459695 CACTGAGGCAGGAGGGAAGGAGG - Intronic
1041015111 8:53585245-53585267 CCCTCAGGCAAAAAGGAAGAAGG - Intergenic
1041445018 8:57941764-57941786 ACCTGTGGCAGGTAGGAAGAAGG - Intergenic
1042515872 8:69658484-69658506 CTCTGTGAAAAGAGAGAAGAAGG - Exonic
1042612334 8:70613037-70613059 CCCTGTGAAAGGAAGGAAGAAGG + Intronic
1044973820 8:97644488-97644510 CCCTCTGACGGGAGGGAAGATGG + Exonic
1046290084 8:112147769-112147791 CCCTGTGGCAAATGAGAGGACGG - Intergenic
1047714845 8:127586108-127586130 GCCAGTGGCAGGAGGCAAGAGGG - Intergenic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1049975550 9:858199-858221 TCATGTGGCCAGTGGGAAGAGGG + Intronic
1050056293 9:1659222-1659244 CCCTGTTGCAAGAGGCAATATGG + Intergenic
1050594711 9:7194087-7194109 CCCTGGGCCAAGGGGGAGGAGGG - Intergenic
1053025168 9:34723441-34723463 CCCTGTGGGGAGAAGTAAGACGG - Exonic
1053367079 9:37530491-37530513 CCCTCTGGCTAGAGAGATGAGGG - Intronic
1055016180 9:71620623-71620645 CCCTGTGGCAAAAGGATATAGGG - Intergenic
1056708803 9:88973343-88973365 CCCTGTGGAATCAGGGAAGCTGG - Intergenic
1056778551 9:89532368-89532390 CCATGTGGCAATATGCAAGATGG + Intergenic
1057861401 9:98643703-98643725 CCCTGTGGCCACAGGGACTAGGG + Intronic
1058021760 9:100098054-100098076 CTCTGGGGCAAGAGGGACTAGGG + Intronic
1058595672 9:106612982-106613004 CACTGTGGCAACAGAGAAGGAGG - Intergenic
1059531702 9:115041228-115041250 CCCTCTGGCATAAGGGAAGAAGG + Intronic
1060349733 9:122849638-122849660 ACCTGTTGCAAATGGGAAGATGG - Exonic
1061991001 9:134158748-134158770 CCCTGGGGCAAGAGGGTGGAAGG + Exonic
1185889045 X:3808206-3808228 CACGGTGACAAAAGGGAAGATGG + Intergenic
1185942055 X:4332960-4332982 CCCTGCAGCAATAGGAAAGAAGG + Intergenic
1186747205 X:12582513-12582535 CCCTGTGGGAGGAGGGAGGCAGG + Intronic
1188430452 X:30101031-30101053 TCCTATGGCAAAAGGGCAGAAGG - Intergenic
1189198052 X:39168205-39168227 CCCTCTTGCAAGAGGGAGGGGGG + Intergenic
1189590107 X:42501977-42501999 TCCTGTGGAAAGAGAGAGGAAGG + Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1192087698 X:68117215-68117237 ACTTGAGGCAGGAGGGAAGAAGG - Intronic
1192318462 X:70069028-70069050 TGCTATGGCAAGAGGGGAGAGGG - Intergenic
1194014677 X:88604762-88604784 CCATGTGGCAAGATAGTAGAAGG - Intergenic
1194968810 X:100320082-100320104 CGTTGTGGCAAGAGGAATGAGGG - Intronic
1195348824 X:103977839-103977861 CCCTTGGTCAAGAGGGAAAAGGG + Intergenic
1195358619 X:104061000-104061022 CCCTTGGTCAAGAGGGAAAAGGG - Intergenic
1195613743 X:106896458-106896480 CCATTTGGCAAAAGGGAAGTGGG + Intronic
1197912032 X:131493082-131493104 CGCTGTGGCAACAGGCAAGTGGG - Intergenic
1198613378 X:138426240-138426262 CCCTTTAGCAAGCAGGAAGAAGG + Intergenic
1202594784 Y:26525981-26526003 CGCTGAGGCAAGAAGGAAAAAGG + Intergenic