ID: 962422449

View in Genome Browser
Species Human (GRCh38)
Location 3:135240423-135240445
Sequence GTGTGGGATTGGAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 400}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962422442_962422449 7 Left 962422442 3:135240393-135240415 CCAAGCAGAGAGCCAATTTAGAA 0: 1
1: 0
2: 6
3: 72
4: 442
Right 962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG 0: 1
1: 0
2: 0
3: 29
4: 400
962422443_962422449 -5 Left 962422443 3:135240405-135240427 CCAATTTAGAAACTTCCAGTGTG 0: 1
1: 0
2: 0
3: 21
4: 211
Right 962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG 0: 1
1: 0
2: 0
3: 29
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962422449 Original CRISPR GTGTGGGATTGGAGGCAAGA AGG Intronic
900194421 1:1368294-1368316 GTGCGGGATTACAGGCAGGAAGG + Intergenic
900428257 1:2590253-2590275 GGGTGGCATTGGGGGCAGGAAGG - Exonic
900646999 1:3713477-3713499 GTGTGGGACTCGGGGCAAGGTGG + Intronic
901751783 1:11414404-11414426 ATGAGGGATTGGAGGGCAGAGGG + Intergenic
904376426 1:30085198-30085220 GTGTGGGAGATGAGGAAAGAAGG - Intergenic
904895044 1:33810916-33810938 GTGGGGAGTGGGAGGCAAGAAGG - Intronic
905379744 1:37553331-37553353 GTGAGAGATTGGAGAGAAGAGGG - Intronic
906140914 1:43532839-43532861 GTGTGGAAATGAAGGCAAGAGGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906643052 1:47452973-47452995 ATGTTGCATGGGAGGCAAGAGGG - Intergenic
907059575 1:51407895-51407917 GTGTGGGCTTTGTGGCTAGATGG - Intronic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907190088 1:52641062-52641084 TTGTGTGATTGGAGACCAGATGG + Intronic
908037965 1:60076035-60076057 ATGTGACAATGGAGGCAAGAGGG + Intergenic
908963084 1:69725691-69725713 AAGAGAGATTGGAGGCAAGAAGG + Intronic
910215368 1:84838639-84838661 GGTTGAGACTGGAGGCAAGAAGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913248586 1:116892294-116892316 TTCTGGGATTGGAGGAGAGAAGG + Intergenic
913267356 1:117058251-117058273 GTTTGAGATTGGACGAAAGATGG - Intergenic
913294618 1:117306988-117307010 GTGTGGGTGTGCATGCAAGAGGG - Intergenic
914680813 1:149937008-149937030 GTCTGGGATTGGGGTAAAGAAGG - Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915214349 1:154329923-154329945 GAGTGGGGTAGGTGGCAAGAAGG - Intronic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915543142 1:156581553-156581575 GTGGGGCCTTGGAGGCCAGAAGG - Exonic
915940389 1:160115137-160115159 GTTTGGAGATGGAGGCAAGAGGG - Intergenic
916974648 1:170062982-170063004 ATGTGAGGTTGGAAGCAAGATGG - Intronic
917489280 1:175483877-175483899 GTGTGGCATGGGCAGCAAGAGGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918424362 1:184393124-184393146 GTGTGGGATAGGAAGCAGAAGGG - Intronic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919276820 1:195428858-195428880 TTGTGGGGTTAGAAGCAAGATGG + Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
919608103 1:199711210-199711232 GTGTGTCATTGCATGCAAGATGG - Intergenic
919775492 1:201191604-201191626 CTGTTGGATTGGAGACTAGAGGG - Intronic
921147992 1:212377700-212377722 GTTTGGGCTTGGAGGAAGGAAGG + Exonic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922016337 1:221651804-221651826 ATGTGGAATTTGAGGCACGAGGG + Intergenic
922018789 1:221682460-221682482 GAGTAGGATTGGAGGCCATATGG - Intergenic
922627264 1:227061213-227061235 GTTTGGTTTTGGGGGCAAGAAGG - Intronic
922691214 1:227693110-227693132 GAAGGGGACTGGAGGCAAGAGGG - Intergenic
923250782 1:232177974-232177996 GTGTGAGGCTGGAAGCAAGATGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923476359 1:234335337-234335359 GGGTGGGAGTGCAGGCAGGATGG - Intergenic
1063602149 10:7491976-7491998 GGGTGGGATTGGAAGTTAGAGGG + Intergenic
1064283410 10:13971008-13971030 GTGTGGGACAGGAGGCAAGGCGG - Intronic
1065692171 10:28345682-28345704 GAGAGGGATTGAAGGAAAGATGG + Intergenic
1066105934 10:32157032-32157054 GTGTAGAATTGGAGGAATGAGGG + Intergenic
1066139440 10:32488615-32488637 CTGGGGGGTTGGAGCCAAGATGG - Intronic
1066350936 10:34636316-34636338 GTGTGGGTTTGGATGACAGAGGG - Intronic
1066802067 10:39203577-39203599 ATGTGAGATTTTAGGCAAGATGG + Intergenic
1067077733 10:43197678-43197700 CTGTGGGATTGGAGGTCAGGAGG - Intronic
1067170239 10:43900025-43900047 TGGTGGGATTGGAGGCTTGAAGG + Intergenic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067698422 10:48551907-48551929 GTGTGGCTTTGGAAGCCAGATGG + Intronic
1069758004 10:70785545-70785567 GTGTTGGATGGGAGGCAGCAGGG - Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072040080 10:91598590-91598612 GTTTGTGATTGTAGGCAGGACGG - Intergenic
1072221934 10:93333997-93334019 GTGTGGGATTGAAGGATGGAAGG + Intronic
1072564972 10:96609866-96609888 GTCTGGAATTGGAGGAAAGAGGG + Exonic
1072872192 10:99132436-99132458 ATGGGGGATTGCTGGCAAGATGG + Intronic
1074102282 10:110363290-110363312 GGGTGGGATTGGATGAAAGAGGG - Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074571826 10:114631587-114631609 GGCTGGGATGGGGGGCAAGACGG + Intronic
1075138228 10:119806751-119806773 GGGTGGGCTTGGAGGTGAGAGGG - Intronic
1075199715 10:120392356-120392378 GTGGGGAAGTGGAGGCAACAGGG + Intergenic
1075618059 10:123905776-123905798 GGGTGGGGTGGGAGGCAGGAAGG - Intronic
1075815443 10:125261305-125261327 GTTTGGGATTGGAGGGGAGTTGG + Intergenic
1075999502 10:126904278-126904300 GTCAGGGATTGGAGGAACGAAGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076705106 10:132297203-132297225 GTGTGGGGTGGGAGCCAAGCAGG - Intronic
1076928668 10:133511062-133511084 GTGTGGGATTGGTGCAAGGAGGG + Intergenic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077339917 11:2021679-2021701 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1079021742 11:16914814-16914836 CTGTGTGATTTGAGGCAAGTTGG - Intronic
1080291190 11:30673602-30673624 TTGGGGGGTTGGAGCCAAGATGG + Intergenic
1080479966 11:32637585-32637607 GTGTGTGTTTGGGGGCAGGAGGG - Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083473766 11:62902174-62902196 GGGTGGGATTCCAGGCAATAGGG + Intergenic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084343538 11:68526565-68526587 GTGTGTGAATAGAGGTAAGATGG - Intronic
1085462176 11:76700792-76700814 GGGTGGCTCTGGAGGCAAGAGGG + Intergenic
1085607140 11:77911327-77911349 GTGTGAGTTTGGTGGCCAGATGG + Intronic
1086340907 11:85847203-85847225 GTGTGGGATTGACTGCAAGGGGG - Intergenic
1086341689 11:85854117-85854139 GTGAGGGATTGTAGGCGTGAGGG + Intergenic
1088644126 11:111902875-111902897 GTGTGAGAAATGAGGCAAGAGGG - Intergenic
1089572058 11:119417570-119417592 TCCTGGGATTGGGGGCAAGAGGG - Exonic
1089756207 11:120689280-120689302 GTGAGGGATGGGAGGCAGGTAGG - Intronic
1091193161 11:133711049-133711071 GCCTGGGCTTGAAGGCAAGAGGG - Intergenic
1202822902 11_KI270721v1_random:76868-76890 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1092632413 12:10396230-10396252 GTGAGGGATTGTAGGCGTGAGGG - Intronic
1092910198 12:13139677-13139699 ATGAGGGATTGGATGCTAGATGG - Intronic
1093093246 12:14944330-14944352 GGGTGGCATTGGAGGGAAGGGGG - Intronic
1093397344 12:18699339-18699361 GGGTGAGATTGCAGGCAGGAAGG - Intronic
1093450294 12:19306309-19306331 TTGTGGGGTTGGAGGCGAGGTGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094755295 12:33462447-33462469 ATGTGGGATTGCTGGCAAGATGG + Intergenic
1095217809 12:39569756-39569778 CTGGGGGAGTGGAGCCAAGAGGG - Intronic
1095922479 12:47544688-47544710 GTGGAGGATGGGGGGCAAGAGGG - Intergenic
1097190612 12:57217673-57217695 GAGTGGGGTTGGAGGCAGGGAGG - Intronic
1099301960 12:80907334-80907356 GTTTGGAATGGGAGGCAATAAGG + Intronic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101777798 12:107809453-107809475 GTGTGGGTTTGTATGCAGGAGGG - Intergenic
1102536740 12:113587259-113587281 GGGAGGGGTTGGAGGCAAGCAGG + Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105707361 13:22976666-22976688 GGGTTGGATTGGAGCCAGGAGGG + Intergenic
1105899344 13:24742339-24742361 GTCTGGGATGGGAGGCATGGGGG - Intergenic
1105953481 13:25255947-25255969 GAGTGGGAATGGAGGCTAGGAGG - Intronic
1107044000 13:35976170-35976192 GGGTGGGTTTGGAGGCAGGTTGG + Intronic
1107526581 13:41238473-41238495 GTGTGGGGTAGGAGGTGAGAAGG + Intronic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1110512893 13:76373905-76373927 GTGTGAGATTAGAGGAAAAATGG + Intergenic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113633012 13:111900621-111900643 GTGTGGGTTTGGCTGCATGATGG + Intergenic
1114029259 14:18561551-18561573 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1114726497 14:24943122-24943144 GGGTGGGGTGTGAGGCAAGAAGG + Intronic
1115697072 14:35910531-35910553 GTGTGGGATATGAGGCACAAAGG + Intronic
1116222742 14:42110443-42110465 CTAGGGGATAGGAGGCAAGATGG + Intergenic
1117349820 14:54870361-54870383 GGGTGGGGGTGGAGCCAAGATGG + Intronic
1117730617 14:58718479-58718501 GTGTTGGATTGGAGACACAAGGG - Intergenic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1119218446 14:72887138-72887160 GTGTGTGTTTGGAGGCAGAAGGG - Intronic
1119757333 14:77128381-77128403 GGGTGGGAGTGGAGGTAGGAGGG - Intronic
1120265480 14:82244124-82244146 GTGTGGATTTGGAGGAAGGATGG - Intergenic
1120389184 14:83883742-83883764 GGTTGGGAGTGGAGGCTAGATGG - Intergenic
1120993480 14:90397887-90397909 GGGTGGGGTTGGGGGCAGGAAGG + Intronic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1123811857 15:23935014-23935036 GTGTTGGATGTGAGGCATGATGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1129560976 15:76568274-76568296 GTGTTCTATTGGAGACAAGACGG - Intronic
1129663142 15:77564600-77564622 CTGTGGGATTTGCAGCAAGAGGG - Intergenic
1129992643 15:79978174-79978196 GTGCGGGAAAGGAAGCAAGAGGG + Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1131064254 15:89423479-89423501 GTGTGGCTTTAGAAGCAAGATGG - Intergenic
1131232588 15:90670529-90670551 TTGGGGAATTGGAGGCATGAGGG + Intergenic
1131479887 15:92771664-92771686 TTGTGGGGTTAGAAGCAAGATGG + Intronic
1131901924 15:97097252-97097274 GTGTGTGTTTGGAGGCAGAAAGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1134266499 16:12697366-12697388 GTGATGGATTGCAGACAAGAGGG - Intronic
1136045511 16:27611983-27612005 GTCTGGGAGCGGAGGCTAGAGGG + Intronic
1136619716 16:31420268-31420290 GTGTAGGGCTGAAGGCAAGAGGG + Intronic
1137819914 16:51434450-51434472 GAGTTGGATTGGAGGAAAGGGGG + Intergenic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141348836 16:83274204-83274226 GGGTGGGATTGCTGGCAGGAAGG + Intronic
1141787393 16:86210934-86210956 GTGGGGGATTTGAGCCAAGTTGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144216298 17:13058468-13058490 CTGTGGGCTTGGAGGCACCATGG + Intergenic
1144654077 17:17024565-17024587 TTGGGGGATTCGTGGCAAGAAGG + Intergenic
1144700239 17:17332875-17332897 GTGTGGGAGTGGAGGGTATATGG + Intronic
1147592828 17:41695910-41695932 GTGTGGGGATGGGGGCAGGAGGG - Intergenic
1147753216 17:42750148-42750170 CTGTGGGGTTGGAGGCTTGAGGG - Intergenic
1148743381 17:49905565-49905587 GGGTAGGAGTGGGGGCAAGAAGG - Intergenic
1148855850 17:50578973-50578995 GTGACTGATTGGAGGCAGGAGGG + Intronic
1148856951 17:50584096-50584118 GTTTGGGAGAGGAGGCGAGAGGG + Intronic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1150228804 17:63538692-63538714 GTTGGGGATTGGATGGAAGAGGG + Intronic
1151751559 17:76041538-76041560 GTGTCAGAATGGAGGCATGAAGG - Intronic
1152039065 17:77891627-77891649 CTGTGGGATTGCAGGCAGAAGGG - Intergenic
1152146493 17:78571856-78571878 GTTTGGGATTGGTGGGCAGAAGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152724432 17:81938220-81938242 GCGTGGGAGTGGGGGCATGATGG - Intronic
1154281228 18:13005021-13005043 TTGTGGTACTAGAGGCAAGAGGG + Intronic
1157190730 18:45579247-45579269 GTATGGGCTTGGATGCAAGGGGG + Intronic
1157321636 18:46639371-46639393 AAGAGGGATTGGAGGCATGATGG - Intronic
1157493415 18:48139171-48139193 GTGCGGGAGTGGAGGCAGGAGGG + Intronic
1158106866 18:53895372-53895394 GTGTGGGAAAAGAGGCAAGTCGG + Intergenic
1159580209 18:70227071-70227093 TTGTGCTATTGGAAGCAAGATGG - Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1159748301 18:72268032-72268054 AAGTAGGATTAGAGGCAAGAAGG - Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1161970853 19:7579283-7579305 GTGTGGGAAGGCAGGAAAGAGGG - Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165371695 19:35411639-35411661 GTGTGGTATTAAAGGGAAGAAGG - Intergenic
1166929973 19:46296635-46296657 GGGTGGGATTGGAGGTCAGAGGG + Intergenic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
925432080 2:3803365-3803387 GCTTGGGACTGGAGCCAAGATGG - Intronic
925978083 2:9155093-9155115 GTGGGAGATTGGAGGGAGGAAGG + Intergenic
927062403 2:19436211-19436233 TTCTGGGATTGGAGGTAAGGAGG - Intergenic
927634886 2:24806453-24806475 GTGAGGGGGTGGAGCCAAGATGG - Intronic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
930383048 2:50656251-50656273 GGGTGGGTTTTGAGCCAAGAAGG - Intronic
931030671 2:58171612-58171634 ATAGGGGATTGGAGCCAAGATGG + Intronic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
933189146 2:79313818-79313840 GTGTGTGTTTGGGGGTAAGAGGG + Intronic
933416303 2:81990988-81991010 TTGTGGGATTAGAAGCAAGGTGG - Intergenic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935317023 2:101844992-101845014 GCGTGGCAAGGGAGGCAAGATGG + Intronic
935884794 2:107604856-107604878 CTGTGGCATTTGAAGCAAGACGG - Intergenic
936134352 2:109876731-109876753 GTTTGGGATTGGAGTCAGAATGG - Intergenic
936210345 2:110494754-110494776 GTTTGGGATTGGAGTCAGAATGG + Intergenic
936434932 2:112496147-112496169 GTTTGGGATTGGAGTCAGAATGG + Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937055931 2:118936854-118936876 TTGGGGGATTGGAGGAAATAGGG - Intergenic
937465128 2:122125594-122125616 ATCTGGGATTGCTGGCAAGATGG - Intergenic
938343165 2:130548844-130548866 CTGTGGGAGTGCATGCAAGAGGG - Intronic
938346668 2:130571878-130571900 CTGTGGGAGTGCATGCAAGAGGG + Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
939857292 2:147374650-147374672 TTGTGGGGTTTGAGGCAACAGGG - Intergenic
939964355 2:148595861-148595883 GTGTGGCACTGGAGACAATAAGG + Intergenic
939984258 2:148814562-148814584 TTGTGAGATTAGAAGCAAGACGG - Intergenic
940964412 2:159821731-159821753 GTGATGGATTGCTGGCAAGATGG + Intronic
941163033 2:162056549-162056571 TTGTGAGGTTAGAGGCAAGATGG - Intronic
941517309 2:166494921-166494943 GTTTGGGAGTGAAGGCCAGAGGG + Intergenic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
943780157 2:191814613-191814635 GTGTGGAAATGGAGCCACGATGG - Intergenic
944851108 2:203720154-203720176 GAGTGAGATTGGAGGTGAGAAGG - Intronic
946103869 2:217352242-217352264 AGGAGGGATTTGAGGCAAGATGG - Intronic
946185362 2:217978011-217978033 GTGGGGGATTGGCACCAAGATGG - Intronic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
946902502 2:224385622-224385644 TTGAGGGATTGGTGGCTAGAAGG - Intronic
947428989 2:230009224-230009246 GTTTGGGATAGGAGGTAGGATGG + Intronic
948201627 2:236133582-236133604 GTGTGTAAGTGGAGGCATGAGGG - Intergenic
948229109 2:236336748-236336770 GTGAGGACTTGGAGGTAAGATGG - Intronic
1169206592 20:3744123-3744145 GACTGGGATGGGAGGTAAGAGGG + Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169410774 20:5367899-5367921 TTGTGAGGTTAGAGGCAAGATGG + Intergenic
1169682623 20:8232766-8232788 GTTTTGGACTGGAGGAAAGATGG + Intronic
1169731008 20:8785580-8785602 GGGTGTGATGGGAGCCAAGAGGG + Intronic
1170537885 20:17359472-17359494 GTGTGGGAATGGAGCTCAGATGG - Intronic
1171232739 20:23500506-23500528 TGGTGGAATGGGAGGCAAGAGGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172104846 20:32510791-32510813 GTGTGGGAAGGCAGGCGAGAGGG + Intronic
1172190498 20:33059507-33059529 GGGTGGGATAGGAAGCAGGAGGG - Intronic
1172801276 20:37578028-37578050 GTGTGGGGTTGGGGGAAGGAAGG - Intergenic
1172805817 20:37610909-37610931 GGGTGGGGTTTGGGGCAAGATGG - Intergenic
1173807515 20:45935326-45935348 GTCCGGGATTGGAGGCACGTGGG - Intronic
1174103618 20:48146555-48146577 GGGTGGGATTGGAGGAAGGCTGG + Intergenic
1174292860 20:49521340-49521362 TTTTGGGAGTGGAGCCAAGAGGG - Intronic
1175049593 20:56142351-56142373 GTGTGAGATTAGAAGTAAGATGG + Intergenic
1175257247 20:57654933-57654955 GTGTGGGGTGGGGGGCATGAGGG - Intronic
1175337277 20:58204901-58204923 GTATGGGATTGGAGCAAAGTGGG - Intergenic
1175893858 20:62327462-62327484 AGGTGGGACTGGATGCAAGATGG - Intronic
1176115688 20:63430978-63431000 GGGTGGGGATGGAGGCACGAGGG + Intronic
1176212472 20:63931689-63931711 GGGTGGGCGTGGAGGCAGGAGGG - Exonic
1178286289 21:31328107-31328129 GGGTGACATTGGAGCCAAGATGG - Intronic
1178371898 21:32033332-32033354 GTGTGGCCTTTGAGGCAAGGAGG - Intronic
1179142707 21:38741046-38741068 GTGTGGAATTAGAGGCCTGATGG - Intergenic
1179273011 21:39865986-39866008 GCGTGGCATTGGGGGCAAGGAGG + Intergenic
1179585352 21:42370862-42370884 GGGTGTGATTGGTGGCCAGAAGG - Intergenic
1180173103 21:46071041-46071063 CTGTGGATTTGGAAGCAAGAAGG + Intergenic
1180453375 22:15488614-15488636 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180871205 22:19148333-19148355 GTGTGGGAGTGGAGCCAAGGTGG + Intergenic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182420956 22:30248345-30248367 GTGTGGGGTGAGAGGCAGGAAGG - Intergenic
1183241606 22:36661740-36661762 CTCTAGGATTGGAGGCAAGGTGG + Intronic
1183541028 22:38429568-38429590 GTGTGGGAAGGAAGGCAGGAGGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1185417126 22:50716367-50716389 GTGGGGGACGGGAGACAAGATGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949377561 3:3407361-3407383 GTCAGGGATTGTTGGCAAGATGG + Intergenic
949683519 3:6541927-6541949 ATGTGGGATTGCTGGCAAGATGG - Intergenic
949891205 3:8734664-8734686 GTGTGGGCCTGGAGGCAGCAGGG - Intronic
952174192 3:30843744-30843766 GTTTGGGATTGGAAGCAACCTGG + Intronic
952198973 3:31105599-31105621 GTGTGAAGTTGGAAGCAAGAAGG + Intergenic
952835101 3:37595694-37595716 GTTTGGGTTTGTAGGCAGGATGG + Intronic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
952968748 3:38637420-38637442 GTGTGGGATAGAAGGAAAGAGGG - Intronic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
954590719 3:51779126-51779148 GTGGGGGATTGGAAACAAGATGG - Intronic
955549625 3:60070053-60070075 GTGAGGGAATGGAGGCAATAGGG - Intronic
955744615 3:62127645-62127667 GTGTCGGATTCAAGGCAAGTAGG + Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957602938 3:82361291-82361313 CTTTGGGATTTGAGGCAACATGG + Intergenic
959295306 3:104528131-104528153 TTGTGGGATGGGGGGCAGGAGGG - Intergenic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
966128076 3:176603655-176603677 GCGAGGGATTGGAGGGAGGATGG - Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
968262337 3:197335388-197335410 GTGGGGAGTGGGAGGCAAGAGGG + Intergenic
968912184 4:3482063-3482085 GTGGGGGATAGGAGGCGTGAGGG - Intronic
968937071 4:3617143-3617165 GAGAGGGATAGGAGGGAAGAAGG - Intergenic
968937125 4:3617298-3617320 GTGAGAGATGGGAGGGAAGAAGG - Intergenic
968937188 4:3617477-3617499 GGGAGGGATGGGAGGGAAGAAGG - Intergenic
969190360 4:5513303-5513325 GTCTGTGATGGGAGGCATGAAGG + Intergenic
969569347 4:7999587-7999609 GTGTGGGTTTGCAGGCATGTGGG + Intronic
969622265 4:8284529-8284551 GTGTGGGCATGGAGGCCAGTGGG + Intronic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
972242954 4:37213732-37213754 GGACAGGATTGGAGGCAAGAAGG - Intergenic
972843513 4:42959424-42959446 GTGGGGGATGGAAGGGAAGAAGG + Intronic
973856818 4:55019740-55019762 GTGTGGGCTGGGAGGTGAGAAGG - Intergenic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
976098863 4:81539122-81539144 CTGAGGCCTTGGAGGCAAGAAGG - Intronic
977685384 4:99841643-99841665 GTGTGGAATTGGATGCAAGCAGG - Intronic
977955240 4:103019024-103019046 GTTTGGGGTGGGGGGCAAGATGG - Intronic
979962418 4:127036691-127036713 GTCTGGGAGTGGAGCAAAGAGGG - Intergenic
981607868 4:146559061-146559083 GTAGGGGACTGGAGCCAAGACGG - Intergenic
982101247 4:151970352-151970374 GTAGGGGATTGGAGGGGAGAAGG - Intergenic
982220885 4:153124249-153124271 GATTGGGATTGGAGATAAGAGGG - Intergenic
983576421 4:169266091-169266113 GTGTGGGATTGGAATCACCATGG - Intronic
984533885 4:180948427-180948449 GTGGGGGATTGGAAGGAAGCAGG - Intergenic
984758646 4:183345567-183345589 TTGTGGGATTAGATGAAAGAAGG + Intergenic
984850621 4:184149476-184149498 GTGTGGGATTGGAAACCAGGTGG + Intronic
986056472 5:4142201-4142223 GTGGGTGACTGGAGGTAAGAGGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986298747 5:6461842-6461864 GTGTGTGACTGGAGCCAAGGTGG - Intronic
991026780 5:62038104-62038126 GTGGGGGATTGCTGGCAAGATGG - Intergenic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993639498 5:90384377-90384399 GCTTGGGATTGGAGGCAAAGAGG - Intergenic
993683971 5:90915579-90915601 TTGTGAGATTGGTGGAAAGAGGG + Intronic
995480252 5:112586029-112586051 GTGAGGGATTGCTGGCGAGATGG + Intergenic
996480341 5:123968863-123968885 GTCTGTGATTTGGGGCAAGAAGG + Intergenic
996928050 5:128852413-128852435 GTGGGGGATTGGAGGGAGGGAGG + Intronic
997887797 5:137647278-137647300 CTGTGGGATTGAAGGCATGTTGG + Intronic
999064835 5:148674326-148674348 GTCTGGGGGTGGAGCCAAGATGG - Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003396766 6:5760014-5760036 GTGAGAGATTGAAGGGAAGAGGG - Intronic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1003731755 6:8832406-8832428 GTCAGGGATTGGAGGAAAGAAGG - Intergenic
1004198970 6:13530535-13530557 CTGGGGGATTGCAGGCATGAAGG + Intergenic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1004695293 6:18027540-18027562 GGGGGGAAATGGAGGCAAGATGG - Intergenic
1005246584 6:23892595-23892617 ATGTGGAATTGGAGGAAAAAAGG - Intergenic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006335937 6:33420478-33420500 AGGAGGGATTGGAGGCCAGAGGG + Intronic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1008823141 6:55658076-55658098 GTGTAGGATTTGTGACAAGAGGG + Intergenic
1011305590 6:85922909-85922931 CTGTGGGATTTGAGGTATGATGG - Intergenic
1012623271 6:101375574-101375596 CTTTGTGATTGGAGGCAAAATGG + Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013582354 6:111548780-111548802 CTGTGGGATAGAAAGCAAGAAGG + Intergenic
1015052881 6:128863299-128863321 GTCTGGGATTGGAGGAGGGATGG + Intergenic
1016894867 6:149041760-149041782 GTGTGGGAATGGAGGCCTGGAGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1018124302 6:160667229-160667251 GTGGAGGGTTGGAAGCAAGAGGG - Intergenic
1018195837 6:161355752-161355774 TTCTGGGATTGGAGCCTAGACGG + Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1021508203 7:21408090-21408112 CTGTGGGATTTGAAGAAAGAAGG + Intergenic
1021691604 7:23235590-23235612 GTGTGGGATTACAGGCATGGTGG + Intergenic
1021810191 7:24395526-24395548 GTGGGAGGTTTGAGGCAAGAAGG - Intergenic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1023802213 7:43845018-43845040 TTGTGAGGTTGGAAGCAAGATGG - Intergenic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1028458329 7:91062530-91062552 CTGGGGGAGTGGAGCCAAGATGG - Intronic
1028498732 7:91493021-91493043 GTATGGGATCTGAGACAAGAAGG - Intergenic
1028499007 7:91497269-91497291 TTGTGGGGTTGGGGGCAAGCAGG - Intergenic
1029195644 7:98803533-98803555 GTTTGGCAATGTAGGCAAGAAGG - Intergenic
1029583931 7:101457586-101457608 GTGTGAGGTTAGAAGCAAGATGG + Intronic
1030207081 7:106961465-106961487 GTGAGGGGTTGGAGGCATCAAGG + Intergenic
1030287181 7:107838600-107838622 CCTTGGGATTGGAGACAAGACGG + Intergenic
1034697165 7:153064012-153064034 GTGTGAGAGTGGAGGCAATGTGG - Intergenic
1035969079 8:4227754-4227776 GTTTGGGATTGAATGCAGGATGG - Intronic
1035969119 8:4227944-4227966 GTGTGGGATTGAATGCAGGATGG - Intronic
1037451457 8:19019826-19019848 GAGAGGGATGGGAGACAAGAAGG + Intronic
1038018324 8:23533013-23533035 GTGAGGGAGAGGAGACAAGAAGG - Intronic
1039559741 8:38503658-38503680 GTGTGGGCTGGGAGGGAAAAGGG - Intergenic
1040807051 8:51406578-51406600 GTGAGGGACTGGAAGCAGGAAGG - Intronic
1041311589 8:56523030-56523052 GTGAGGGATCAGAGGCAGGAAGG - Intergenic
1041406227 8:57502188-57502210 GTGTGGGGTTGGGGGCAGGCAGG + Intergenic
1041423257 8:57692898-57692920 GTGTGGGGTCGGAGGCATGGAGG + Intergenic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042062159 8:64831753-64831775 GTGTGGTATTGGTGGAAAAAGGG - Intergenic
1042307045 8:67343394-67343416 GTGGGGGATTGGAGGCGTGGAGG + Exonic
1042586848 8:70349008-70349030 GTGGGGGATGGGAGGGAAAAGGG + Intronic
1042782737 8:72509961-72509983 CTGTGGGATTGAAGGCGAGCAGG - Intergenic
1042798630 8:72692338-72692360 GTGAAGGATTGGAGGTAGGATGG + Intronic
1044773215 8:95659526-95659548 ATCTGGGAACGGAGGCAAGAAGG + Intergenic
1046738153 8:117799676-117799698 GTGGGGGAGGGGAAGCAAGAAGG - Exonic
1047230969 8:122997467-122997489 ATTTGGGATAGAAGGCAAGAAGG - Intergenic
1047784603 8:128141801-128141823 GTTTGGTGATGGAGGCAAGAGGG + Intergenic
1047845500 8:128801229-128801251 GGGTGGGGGTGGAGCCAAGATGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050696050 9:8280629-8280651 GTGCAGGATTGGAAGCAAGTGGG - Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051423968 9:16915780-16915802 AAGTGGGATCGGAGGCCAGAAGG - Intergenic
1052764611 9:32628484-32628506 GAATGGGATTGGAGGGGAGAGGG - Intergenic
1053307553 9:36995127-36995149 GTGTGGCTTTGGGGGCAGGAAGG - Intronic
1054453958 9:65420199-65420221 GGGAGGGATGGGAGGGAAGAAGG + Intergenic
1054454076 9:65420545-65420567 GAGAGGGATAGGAGGGAAGAAGG + Intergenic
1055287188 9:74741391-74741413 GTGAGGAATTAGATGCAAGAGGG - Intronic
1056010176 9:82320953-82320975 ATGTAGGAATGGAGGCCAGAAGG - Intergenic
1056180535 9:84078202-84078224 GTGAGGGATTGGGGGCAAGTGGG + Intergenic
1057851480 9:98570131-98570153 GTGAGGGAGTGGAGGCAAGGAGG - Intronic
1058506313 9:105669758-105669780 GGGTGGAGTTGGAGGCAGGAAGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1061150331 9:128824518-128824540 GGTTGGGAATGGAGGCAAAAGGG - Intronic
1061679770 9:132237255-132237277 CTGTGTGATTTGAGGCCAGAGGG + Intronic
1062217153 9:135395396-135395418 GTCTGGGCCTGGAGCCAAGACGG + Intergenic
1062610380 9:137370767-137370789 GCGTGGGCCTGGAGCCAAGAGGG + Intronic
1186406929 X:9312856-9312878 GTGATGGATGGGAGGGAAGAAGG + Intergenic
1186518557 X:10185814-10185836 GTGTGGAAATGGAGGCAGCAGGG + Intronic
1188287239 X:28342790-28342812 GTGTGGGGTTGGAGGTAGGTGGG - Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190287392 X:48970538-48970560 GTGTGGGGATGGGGCCAAGAAGG + Exonic
1190337040 X:49269059-49269081 GGGAGGACTTGGAGGCAAGATGG - Intergenic
1190415269 X:50174501-50174523 GTGGGGGATTGAAGGGATGATGG + Intergenic
1190758830 X:53423164-53423186 GGGTGGGATTGGTGGCGGGACGG + Intronic
1191601518 X:63014306-63014328 GTGTGGGCTTTGAGGCAGCAAGG + Intergenic
1191921912 X:66266074-66266096 GGGTAGAATTGGAGGCAATAAGG - Intronic
1192172861 X:68867658-68867680 GTGGGGGCGAGGAGGCAAGAGGG - Intergenic
1193173700 X:78367136-78367158 GTGAGGGATGGCAGGTAAGAGGG + Intergenic
1194826498 X:98570787-98570809 GTCTAGGATTGGAAGCAAAATGG + Intergenic
1195117797 X:101717088-101717110 GTGGGGGAGAGGAGCCAAGATGG - Intergenic
1196399715 X:115300993-115301015 TTCTGGGATAGGAAGCAAGATGG - Intronic
1199215946 X:145260502-145260524 GTGTGAGAAGGGAGGCAAGAGGG + Intergenic
1199621230 X:149703503-149703525 GTGTGAGATTGGATGCAGGGAGG + Intronic
1201512710 Y:14782824-14782846 GTGTTGGATTTGAGGCCAAATGG + Intronic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic
1202335092 Y:23800667-23800689 GGGGGGGATTGCTGGCAAGATGG + Intergenic
1202535675 Y:25869392-25869414 GGGGGGGATTGCTGGCAAGATGG - Intergenic