ID: 962422513

View in Genome Browser
Species Human (GRCh38)
Location 3:135240874-135240896
Sequence GTGGGTTCCAATGTTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962422513_962422520 2 Left 962422513 3:135240874-135240896 CCTGCAGCAACATTGGAACCCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 962422520 3:135240899-135240921 AGAGGGAACCAGGGCACATGTGG 0: 1
1: 0
2: 6
3: 37
4: 355
962422513_962422517 -7 Left 962422513 3:135240874-135240896 CCTGCAGCAACATTGGAACCCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 962422517 3:135240890-135240912 AACCCACATAGAGGGAACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 125
962422513_962422522 17 Left 962422513 3:135240874-135240896 CCTGCAGCAACATTGGAACCCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 962422522 3:135240914-135240936 ACATGTGGCATATCCACATGAGG 0: 1
1: 0
2: 1
3: 14
4: 173
962422513_962422516 -8 Left 962422513 3:135240874-135240896 CCTGCAGCAACATTGGAACCCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 962422516 3:135240889-135240911 GAACCCACATAGAGGGAACCAGG 0: 1
1: 0
2: 2
3: 12
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962422513 Original CRISPR GTGGGTTCCAATGTTGCTGC AGG (reversed) Intronic
900567752 1:3342178-3342200 GTGGGTTCCAAGGTTACTTCTGG - Intronic
902796264 1:18802518-18802540 GTTGGTGTTAATGTTGCTGCTGG - Intergenic
904900375 1:33852323-33852345 GTGGGTTCAACCATTGCTGCTGG - Intronic
906640991 1:47440230-47440252 GTGGGATCCAGGGTTTCTGCAGG - Exonic
910437192 1:87217308-87217330 GTGGGTTACACTGATGATGCAGG + Intergenic
912642778 1:111363003-111363025 GTGGCTTCCTATGGTGCTCCAGG + Intergenic
920037965 1:203077682-203077704 TTGGGTTCCCATCATGCTGCTGG - Exonic
921952485 1:220945041-220945063 TCTGGTTCCAGTGTTGCTGCTGG + Intergenic
923332759 1:232940709-232940731 TGGGGTGCCAATGTTGCTGTGGG + Intergenic
1066076954 10:31888306-31888328 GTGGGGTCCAATCATGCTCCTGG + Intronic
1067476623 10:46571622-46571644 GTGGCTTCCAATGTTGCAGGTGG + Intergenic
1067618115 10:47770159-47770181 GTGGCTTCCAATGTTGCAGGTGG - Intergenic
1077104567 11:836579-836601 GTGGGTCCCCACGTTCCTGCTGG + Intronic
1081582729 11:44363517-44363539 CAGGGTTCCAATGTGGCTGTGGG - Intergenic
1081795025 11:45812947-45812969 ATGGGTTCTAATGCAGCTGCTGG + Exonic
1082010761 11:47448426-47448448 GTGGGCTCCAGGGTTGCGGCTGG - Intronic
1083723155 11:64613553-64613575 GTGGTTTCCAAGGTCACTGCAGG - Intronic
1092471624 12:8786700-8786722 GTGGGCTCCACTGCTGCAGCAGG + Intergenic
1096849006 12:54423571-54423593 GTGGGTTCTATTGTTGCTCCAGG + Intergenic
1100693324 12:97063451-97063473 GTGGGTTGTCATGTTGCTACTGG + Intergenic
1106936115 13:34722216-34722238 GTGGTTTCCACTCTTGCAGCTGG - Intergenic
1109356333 13:61233462-61233484 TTGCATTCTAATGTTGCTGCTGG + Intergenic
1110411155 13:75204926-75204948 GAGGGCTCCACTGTTGCAGCAGG + Intergenic
1111340225 13:86875529-86875551 GTGGTTTCCTATGTTGCCTCTGG - Intergenic
1113362380 13:109643364-109643386 GCGGGTTCCAACATTGCTGAAGG - Intergenic
1114689269 14:24564994-24565016 GTGATTTCCAATGTTGCAGATGG - Intergenic
1115109040 14:29798929-29798951 TTGAGTTCTAATTTTGCTGCAGG + Intronic
1116064605 14:39967119-39967141 CTGAGTTCTAATGTTTCTGCTGG - Intergenic
1117803237 14:59465384-59465406 GTGGGTTCCAGCGTTGCCGAGGG + Intronic
1119737596 14:76993542-76993564 GTGGGTTCAAATGTTTTTCCTGG + Intergenic
1121477752 14:94227578-94227600 GTTGGGGCAAATGTTGCTGCGGG + Intronic
1123072329 14:105647866-105647888 CTGGGCTCCAGTGATGCTGCTGG + Intergenic
1123771765 15:23536380-23536402 GAGGGTTCCAAAGTTGGTCCTGG + Intergenic
1125748095 15:42011045-42011067 CTGGATTCCACAGTTGCTGCAGG - Intronic
1126826856 15:52560092-52560114 CTGGTTTCCAGTGTTTCTGCAGG + Intronic
1135189253 16:20341448-20341470 GTGGGTTCCACTCTTATTGCTGG - Intronic
1136524762 16:30821943-30821965 GAGGGCTCCCATGTTGCTGTCGG - Intergenic
1139267874 16:65656741-65656763 GTGGGGACCATTGTTGTTGCTGG + Intergenic
1139803840 16:69546782-69546804 GTGGGTTGAAATGTTTGTGCTGG - Intergenic
1140544888 16:75797978-75798000 TTGGTTTCCAAGGCTGCTGCTGG + Intergenic
1140827307 16:78718718-78718740 GAGAGTTCCAATGTTTCTGAAGG + Intronic
1141556224 16:84838464-84838486 GTGAGTCCCATAGTTGCTGCAGG + Exonic
1141677093 16:85523685-85523707 CTGGGTTCCAGTGTCACTGCAGG + Intergenic
1149713374 17:58763265-58763287 GTGGTTTCCAACGTTGCTCTAGG + Intronic
1154449074 18:14460013-14460035 GGGGGTTCCACCGCTGCTGCAGG - Intergenic
1157820427 18:50763854-50763876 TTAGCTTCCAATGTTGCTGTTGG + Intergenic
1160393463 18:78555391-78555413 GTGGGGTGCGATGTTCCTGCTGG - Intergenic
1161398869 19:4058958-4058980 GTGGGCTCAGATGTGGCTGCTGG + Intronic
1162059055 19:8083703-8083725 GTGTGTTCCCGTGTTTCTGCAGG - Intronic
1162222978 19:9194483-9194505 GTTGGTTCAATTGTTACTGCAGG - Intergenic
1164575051 19:29401040-29401062 GTGGGTACCGATGCTGCTGCGGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167210693 19:48132398-48132420 GTGGGCTCCGCTGATGCTGCTGG - Intronic
926103845 2:10137915-10137937 GTGGGTCCCAATGTTACTGAAGG + Intergenic
927069184 2:19507849-19507871 GTGGTTTCCTCTGTTGCTTCAGG - Intergenic
929773367 2:44911904-44911926 CTGGCTTCCATTGTTGCTGCTGG - Intergenic
931216600 2:60250801-60250823 GTGACTTCCAATGTTGGTGGTGG - Intergenic
934630550 2:95915820-95915842 TTGGGTTACGCTGTTGCTGCTGG - Intronic
934832727 2:97547373-97547395 GTGGGTGATAGTGTTGCTGCTGG - Intronic
936272154 2:111057187-111057209 GTGGGTTCCACTGTGCATGCTGG + Intronic
936754694 2:115693404-115693426 GTTTGTTCCAAAGTTGCTTCTGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942282953 2:174385555-174385577 GTTGATTCCAATGCTGCAGCAGG + Intronic
944929097 2:204497924-204497946 GTGGGTAAGAATGTTGTTGCTGG + Intergenic
1169132816 20:3174967-3174989 ATTGGTTTCAATGTTACTGCCGG + Intergenic
1171757031 20:29120004-29120026 CTGGGTTCCACTGTTGCCACAGG + Intergenic
1171863091 20:30419268-30419290 CTGGGTTCCACTGTTGCCACAGG + Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1173190205 20:40870144-40870166 GTGGGTTCACAGGTTGATGCAGG - Intergenic
1176110699 20:63409509-63409531 GTGAGTTCCCACGTAGCTGCAGG - Intronic
1177941288 21:27414997-27415019 CTGGTTTCCAAAGTTTCTGCTGG + Intergenic
1178486346 21:33022056-33022078 GTGGCTTCCAAGGTGTCTGCTGG - Intergenic
1178941583 21:36911302-36911324 ATGGGTTCCAGGCTTGCTGCTGG - Intronic
1179370836 21:40804861-40804883 GTGGGGTACAATGTAGCAGCGGG - Intronic
1179904691 21:44416381-44416403 GTGGGTGCCATACTTGCTGCAGG - Intronic
1180676212 22:17588166-17588188 CTGGGTTGCAATCTGGCTGCTGG + Intronic
951852763 3:27161185-27161207 GTGTGTTCCATTCTTGCTGTTGG + Intronic
952925406 3:38316242-38316264 GTGGGTTTTCATGTAGCTGCTGG + Intronic
955681349 3:61505309-61505331 GTGGGCTGCCATTTTGCTGCTGG - Intergenic
957333677 3:78799072-78799094 GTGGGTTCCAATGATGGTCCTGG + Intronic
962422513 3:135240874-135240896 GTGGGTTCCAATGTTGCTGCAGG - Intronic
964087377 3:152834863-152834885 GTGCGCTCCAAGGTGGCTGCTGG - Exonic
969250050 4:5961608-5961630 CTGGGTTCAAATCTTGCAGCAGG - Intronic
969676582 4:8617737-8617759 GTGGGGTCCAAGGATGCTGAAGG - Intronic
971328840 4:25665733-25665755 GTGGGTTCCAATGAGCCTCCTGG - Intronic
972567979 4:40285934-40285956 GTGGGTTGCCATGGTTCTGCTGG + Intergenic
979234516 4:118384928-118384950 GTGTTCCCCAATGTTGCTGCTGG + Intergenic
980830792 4:138127659-138127681 GTGGTTTCCAATGTTGGAGGTGG + Intergenic
986061408 5:4195106-4195128 GTGGGTACCACTGTGGCTCCTGG - Intergenic
987792414 5:22585231-22585253 ATGTCTTCCATTGTTGCTGCTGG + Intronic
992869731 5:80994065-80994087 GTGGTTACCAATGTGGCTCCAGG + Intronic
997127609 5:131243895-131243917 CTGGGTTCCATTGCTGTTGCTGG - Intergenic
997750598 5:136341814-136341836 CTGAGATCCCATGTTGCTGCTGG - Intronic
1001015400 5:168136492-168136514 GTGAGCACCAATGGTGCTGCTGG - Intronic
1002454290 5:179337556-179337578 GGGGGTCCCTGTGTTGCTGCCGG - Intronic
1002483687 5:179519815-179519837 GAGGCTTCCACTGTTGCTGATGG - Intergenic
1005719738 6:28589699-28589721 TTGGGTTTCCACGTTGCTGCTGG - Intronic
1011798383 6:90982633-90982655 GTGGGCTCCCCTGTCGCTGCTGG + Intergenic
1017212913 6:151876642-151876664 GTGGGTCCTTCTGTTGCTGCAGG + Intronic
1018100706 6:160436975-160436997 GTGTCTTTCAATGTTGCTACAGG + Exonic
1018330239 6:162719704-162719726 GTGGGTTGTAATGTTTCTGAGGG - Intronic
1020098275 7:5380444-5380466 GTGGGTTCCCACCTTCCTGCAGG - Intronic
1025799671 7:64774074-64774096 CTGGGTTACAAGGATGCTGCTGG + Intergenic
1026795518 7:73363916-73363938 GTGGTCTCCAGTGTTGCTGGGGG - Intergenic
1029672350 7:102042174-102042196 GTGGCTCCCAAAGCTGCTGCTGG + Intronic
1034140029 7:148806777-148806799 CAGGGTTCCCATGATGCTGCTGG + Intergenic
1034876558 7:154729748-154729770 GTTTATTCCAATGTGGCTGCCGG + Intronic
1037797696 8:22010369-22010391 GGGGGTTCTAGTGTTGCCGCTGG + Intergenic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1041647478 8:60268094-60268116 TTGGGTCCCACTGTTGCTGGGGG - Intronic
1041784859 8:61620731-61620753 GAGGGTTGCAGTGTTCCTGCAGG - Intronic
1042572476 8:70181220-70181242 GTGGTTGCCACTGCTGCTGCTGG - Intronic
1042994655 8:74682667-74682689 GAGTGCTCCAATGTTGCTGTGGG + Intronic
1048261670 8:132950372-132950394 TTGGGTGCTTATGTTGCTGCAGG + Intronic
1049000920 8:139825281-139825303 GTGGGACCCAGTGTGGCTGCAGG - Intronic
1049332744 8:142063833-142063855 GGGGGTTCCCAGGCTGCTGCCGG - Intergenic
1054810710 9:69431556-69431578 GTGGATTCCACTGTTCCTGGAGG - Intronic
1057066739 9:92060086-92060108 GGGGGTTTCTTTGTTGCTGCTGG - Intronic
1057874500 9:98743513-98743535 GTGGTTTCCACTCTTGCTTCAGG + Intronic
1202801460 9_KI270720v1_random:3338-3360 CTGGGTTCCACTGTTGCCACAGG - Intergenic
1189020945 X:37339062-37339084 GTGGGATCCCAGGTTGCTTCTGG + Intergenic
1192454209 X:71264003-71264025 GTGGGTCCCAATGTCCCTACAGG + Intergenic
1192639296 X:72847252-72847274 GTGGGTTGCAAGGCTGGTGCAGG - Exonic
1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG + Exonic
1194586633 X:95742942-95742964 CTGGGTTACAATGTTGCTTTTGG - Intergenic
1201963712 Y:19708981-19709003 ATGGCTTCCAATGTGGCTGGTGG + Exonic