ID: 962423569

View in Genome Browser
Species Human (GRCh38)
Location 3:135249458-135249480
Sequence CTGGGTGACCAGCTGGAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 407}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962423569_962423575 27 Left 962423569 3:135249458-135249480 CCTCCCTCCAGCTGGTCACCCAG 0: 1
1: 0
2: 6
3: 50
4: 407
Right 962423575 3:135249508-135249530 TCTCTGTCCAGACCACACCTAGG 0: 1
1: 0
2: 1
3: 20
4: 205
962423569_962423576 28 Left 962423569 3:135249458-135249480 CCTCCCTCCAGCTGGTCACCCAG 0: 1
1: 0
2: 6
3: 50
4: 407
Right 962423576 3:135249509-135249531 CTCTGTCCAGACCACACCTAGGG 0: 1
1: 0
2: 2
3: 21
4: 222
962423569_962423577 29 Left 962423569 3:135249458-135249480 CCTCCCTCCAGCTGGTCACCCAG 0: 1
1: 0
2: 6
3: 50
4: 407
Right 962423577 3:135249510-135249532 TCTGTCCAGACCACACCTAGGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962423569 Original CRISPR CTGGGTGACCAGCTGGAGGG AGG (reversed) Exonic
900180669 1:1309648-1309670 CAGGGTGACCGTCAGGAGGGTGG - Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900889900 1:5442073-5442095 CTGGAAGACCTGATGGAGGGAGG + Intergenic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901700501 1:11042678-11042700 CTGGGTGGCTGGCTGGAGGGAGG + Intronic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
902404832 1:16176902-16176924 CTGGGTGACCACCTTAGGGGAGG - Intergenic
902539884 1:17146943-17146965 GTGGGTGACCGTCTAGAGGGAGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903101774 1:21035970-21035992 CAGGATGACCAGCTGTAGAGAGG + Intronic
904034176 1:27550194-27550216 CTGGGTGTCCAGCAGCGGGGCGG + Exonic
904559994 1:31390120-31390142 CTGGGTAACCAGCTGCCGTGTGG - Intergenic
905746982 1:40426492-40426514 CTGGTTGACCAGCTGGAAATTGG + Intergenic
905799501 1:40834258-40834280 TTGGGTGACCAAGTGGATGGTGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
906223695 1:44103682-44103704 CTGCTTGGCCGGCTGGAGGGCGG + Intergenic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907400884 1:54224048-54224070 CAGGGTGCCTAGCTGGAGGAAGG - Intronic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
910220974 1:84889207-84889229 CTGGCAAGCCAGCTGGAGGGTGG - Intronic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
910918318 1:92315243-92315265 ATGGGTGAACAGCTGGTTGGTGG + Intronic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911540054 1:99146864-99146886 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
913093951 1:115498577-115498599 GTGGGTGGCCAGCTGGAGGTCGG + Intergenic
915090288 1:153419457-153419479 CTGGGTGACCCACTGGATGGGGG - Exonic
915095205 1:153457634-153457656 CTGGGTGACCCACTGGATGGGGG + Intergenic
915453240 1:156021313-156021335 CTCGGTGACCTGCTGGATGTAGG - Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915489681 1:156244151-156244173 CAGGGTGGCCCACTGGAGGGGGG - Exonic
918802635 1:188991433-188991455 CTGGAAGACCAGCTGGTGGTTGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919637376 1:200016013-200016035 GTGGTTGCCCAACTGGAGGGAGG - Intergenic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
923425578 1:233865643-233865665 CTGGCTGATTAGCTGGAGTGGGG - Intergenic
924685472 1:246285111-246285133 CTGGGGGACAGGGTGGAGGGAGG - Intronic
1062959420 10:1561627-1561649 ATGGGGGACCAGGTGGAGAGAGG - Intronic
1063714533 10:8514043-8514065 CTGCTTGACCCGCTGCAGGGCGG + Intergenic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1067018079 10:42772315-42772337 CATGATGACCAGCTGCAGGGAGG + Intergenic
1067242662 10:44509299-44509321 CTGGGTGACCTGGTGGGGAGGGG + Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068701501 10:60024710-60024732 CTGGGAGAGCACCTGGAAGGTGG + Intergenic
1068928454 10:62564279-62564301 CTCGGTTTCCAGCTGGAGCGGGG - Intronic
1070276642 10:75013397-75013419 CTGGGTGGTTAGCTGGGGGGAGG + Intronic
1070680621 10:78446469-78446491 GTGGGAGACCAGGTGGAGAGAGG - Intergenic
1071265056 10:83957644-83957666 CTGGGAAAGGAGCTGGAGGGAGG + Intergenic
1072609791 10:97010617-97010639 GTGGGTGGCCAGAGGGAGGGTGG + Intronic
1072725762 10:97812636-97812658 CTGGTTGAAGACCTGGAGGGTGG - Intergenic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1074206269 10:111285745-111285767 CTGGCTGTCCAGCTTGAGGGTGG + Intergenic
1074983992 10:118641477-118641499 CTGGGAGACCAGAGGAAGGGAGG + Intergenic
1075007827 10:118842996-118843018 TGGGATGACCAGCTGCAGGGAGG + Intergenic
1075233924 10:120709602-120709624 CTGCGGGATCAGCTGGAGGGAGG + Intergenic
1075702134 10:124476589-124476611 CTGGGGGACCACCTGCAGGTAGG - Intronic
1076227721 10:128793733-128793755 CACGGTCACCAGCTGGAGGCTGG + Intergenic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076866510 10:133168933-133168955 CTGTGTGGCCGGCTGGAGAGGGG + Intronic
1077141402 11:1026467-1026489 CTTGGTGGGCACCTGGAGGGAGG + Exonic
1077713701 11:4559926-4559948 CTGGGACAGCACCTGGAGGGAGG + Intergenic
1080443789 11:32318599-32318621 CTGAGTCAACAGCTGGAGGTAGG + Intergenic
1080749367 11:35138700-35138722 CTGGGAGAGGAGCTGGAGAGAGG - Intergenic
1080891594 11:36413268-36413290 TTGGGTTACCAGCTTGAGGCAGG + Intronic
1081664245 11:44907202-44907224 GTGGGTCACCAGCAGGTGGGTGG - Intronic
1081711068 11:45215736-45215758 CCAGGTGACCATCTGGTGGGTGG + Intronic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083279008 11:61613965-61613987 CTGGGTGGCTAGCTGGTGGGTGG + Intergenic
1083701967 11:64485441-64485463 CTGGGAGTTCAGCTGGTGGGTGG - Intergenic
1083826407 11:65206452-65206474 CTGGCCCACCAGCTGGTGGGAGG - Exonic
1084041539 11:66545809-66545831 CAGGTTGAGCAGCTGGAAGGCGG + Exonic
1084093338 11:66893864-66893886 CTTGGTGACCAGGGAGAGGGTGG - Intronic
1084218246 11:67663184-67663206 CTGTGTGACCCGTTGGAGGCGGG + Exonic
1084433455 11:69123999-69124021 GTGGCTGAGGAGCTGGAGGGAGG + Intergenic
1084506947 11:69574438-69574460 CTGGCTGAGCAGCTCAAGGGTGG + Intergenic
1085197650 11:74682141-74682163 CTGGGGGGCTAGCTCGAGGGAGG + Intergenic
1085522464 11:77146541-77146563 CTGGGTGACCTGTTGGACTGGGG + Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086461289 11:87008330-87008352 CTAGTTGAACAGCTGGATGGTGG - Intergenic
1088623947 11:111715146-111715168 GTGGGTGACCAGCTCCAGCGTGG - Intronic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089191820 11:116659322-116659344 CTGGGTGACGAGGTGGAGGGTGG - Intergenic
1090136982 11:124209397-124209419 CTGGGTGACCACCTGCAGAGAGG - Intergenic
1090948384 11:131451487-131451509 CTGGGGGTGCAGCTGGAAGGGGG + Intronic
1092309955 12:7342053-7342075 CTGTGTGACCATCTTGAGTGGGG - Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1096431513 12:51547745-51547767 ATGGGTTACCTGCTGGAGTGGGG - Intergenic
1096513537 12:52144687-52144709 CAGGGAGACCAGCTGGGGTGGGG + Intergenic
1096529376 12:52233541-52233563 CTGGCGCACCCGCTGGAGGGAGG - Exonic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1097670701 12:62534038-62534060 CTGTGTGACCAGTTGGAGTGAGG - Intronic
1100464715 12:94834780-94834802 CTGGTTCACCAGCTGGACTGAGG + Intergenic
1101337247 12:103807537-103807559 GGGGTTGCCCAGCTGGAGGGTGG - Intronic
1101804573 12:108052180-108052202 CTGAGTGCCCAGCTGTTGGGGGG + Intergenic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1103951576 12:124554384-124554406 CTGGATGCCCAGCTGGGTGGTGG - Intronic
1103974355 12:124692558-124692580 TTGGGTGTCCAGCTAGAGGTTGG - Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104610805 12:130226179-130226201 CTGGGGGACCAGCAGGACGTGGG - Intergenic
1104684573 12:130776366-130776388 CTGGCTTCCCAGCTGGAAGGAGG + Intergenic
1104820184 12:131672619-131672641 CAGGGACACCTGCTGGAGGGGGG - Intergenic
1104858695 12:131913805-131913827 CTGGGGGAGCTGCTGCAGGGTGG - Exonic
1104984213 12:132587490-132587512 GAGGGTGGGCAGCTGGAGGGTGG + Intergenic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107351547 13:39520062-39520084 CTGGGCTCCCAGATGGAGGGTGG - Intronic
1108593839 13:51933944-51933966 GTTGCTGACCAGCTGGAGTGAGG - Exonic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1111333569 13:86792396-86792418 CTGGGCGAGCAGCTGCAGAGGGG + Intergenic
1112544858 13:100357433-100357455 CTGGGCTACCACCTGGAAGGTGG + Intronic
1113577937 13:111407519-111407541 CTGTGTGACCACCTGGTGGCGGG - Intergenic
1113581613 13:111434056-111434078 GTGGATGACCATCTGTAGGGTGG + Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114265312 14:21070042-21070064 CGAGGTTACCCGCTGGAGGGCGG + Intronic
1114556567 14:23565690-23565712 CTGGGGTACCACCTGGAGGGAGG + Exonic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1118917700 14:70121760-70121782 CTGGGAGCCCAGCTGGGGAGAGG + Intronic
1119873926 14:78040736-78040758 CTGGGGGACAATCTGGAGGCTGG - Intergenic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1121097147 14:91225459-91225481 CTGGGTGACTGGCAGGCGGGTGG - Intronic
1121537205 14:94699127-94699149 CTGGGTTAGGAGTTGGAGGGTGG + Intergenic
1122281923 14:100628724-100628746 CTGGCTGACCTGCTTGACGGTGG - Intergenic
1122326077 14:100881345-100881367 CTGGGTGAGCAGCTGGGTGATGG + Exonic
1122603164 14:102931053-102931075 GAGGGTGAGGAGCTGGAGGGAGG + Exonic
1122742670 14:103881154-103881176 GGAGGTGACCAGCTGTAGGGTGG - Intergenic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123990988 15:25683182-25683204 CAGGGTGTCCATCTGAAGGGAGG + Intronic
1125750021 15:42021625-42021647 CTGGGAGGCCAGGTGGAGAGAGG + Intronic
1125892418 15:43276429-43276451 CAGGGAGGGCAGCTGGAGGGCGG + Exonic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1128545102 15:68561350-68561372 ATGGGTGACCATCTGGACCGGGG - Intergenic
1128890075 15:71323515-71323537 CTGGTTGAAGAGCTGCAGGGGGG + Intronic
1129050116 15:72774250-72774272 CTGGGTGCCCAGCCAAAGGGAGG + Intronic
1129800007 15:78406372-78406394 CTGGACTACCAGCTGGAGAGAGG + Intergenic
1131254565 15:90853509-90853531 CTGGGTGACAGGCTTGAGGCTGG - Intergenic
1132727747 16:1346079-1346101 GTGAGTGACCAGCTGGGGAGGGG + Intronic
1132936749 16:2485059-2485081 CTGGGAGAGTAGGTGGAGGGAGG - Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1133997880 16:10761991-10762013 TTGGGGTGCCAGCTGGAGGGTGG - Intronic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1135607693 16:23837309-23837331 GTGGGTAACTAGCTGGAGGCTGG + Intronic
1135675231 16:24409372-24409394 CTGGGTGGCCAGCTCCTGGGAGG + Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1137017937 16:35394718-35394740 CTGGGTGGCCAGCTGAGGGTGGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1139349913 16:66328481-66328503 GTGGGTGGCCATCTGGCGGGAGG - Intergenic
1139360781 16:66398445-66398467 CTGCAGGACCAGCTGGAGTGTGG - Exonic
1141607192 16:85160766-85160788 GTGGGTGAGCAGCTGAGGGGAGG + Intergenic
1141797668 16:86286061-86286083 CTGGGTCACCAGGTTGAGGGTGG - Intergenic
1141998137 16:87647966-87647988 CTGGGTTCCCTGCTGAAGGGGGG + Intronic
1142201048 16:88761315-88761337 CCAGGTGACCTGCTGGTGGGTGG + Intronic
1142220782 16:88853940-88853962 CAGTGTGACCAGTTGGAGAGTGG + Intronic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143405577 17:6675202-6675224 CTGGGTTACCAGCAGGAGTCAGG + Intergenic
1144064465 17:11612196-11612218 CTGTGTGACCAACTCCAGGGTGG + Intronic
1144836946 17:18161499-18161521 CTGGGTGGACAGCTGGTGGGAGG + Intronic
1145302880 17:21653362-21653384 CTGGGTGTCCACTTGGAGCGTGG - Intergenic
1145886268 17:28384488-28384510 CTCCGTGCCCAGCTGGAAGGAGG + Exonic
1146655872 17:34634888-34634910 CTGGGTGAAGACCTGCAGGGTGG - Exonic
1147705164 17:42421294-42421316 CTGAGTGACCATCTGGGGTGAGG - Intronic
1148479300 17:47949666-47949688 CTGGGTGGCCAGATGGATGTGGG - Intergenic
1148680750 17:49472323-49472345 CTAGCTGTCCAGCTGCAGGGAGG - Intronic
1148698753 17:49576077-49576099 CTGGGCGACCCGCTGAGGGGAGG + Exonic
1148803973 17:50254541-50254563 CTTTGTCACCAGCTGGAGTGTGG - Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149570232 17:57667135-57667157 CTGCGTGCCCAGCTGCTGGGTGG + Intronic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1149685481 17:58532173-58532195 CGGGGTGCCCAGCTGGGGGCCGG + Intronic
1149686546 17:58538817-58538839 CTGGGTGAACAGCTGGGGATGGG - Intronic
1150951010 17:69802083-69802105 TGGGATGACCAGCTGGAGAGAGG + Intergenic
1151003213 17:70402156-70402178 CAGGATGACCGGCTGGTGGGAGG - Intergenic
1151369335 17:73638008-73638030 CTGCGGGAGCTGCTGGAGGGCGG + Intronic
1151804475 17:76397023-76397045 CTTTGGGTCCAGCTGGAGGGTGG - Intronic
1152224335 17:79085769-79085791 CTGTTTGTCCAGCTGGAGTGGGG + Intronic
1152466832 17:80471287-80471309 CTGAGGGACCAGCTGCAGGAGGG - Intronic
1152698188 17:81806551-81806573 CTGGCTGCCCGGCTGGAAGGTGG + Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156458029 18:37305656-37305678 TGGGGTTACCAGCTGGTGGGTGG - Intronic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157701493 18:49763838-49763860 CTGAATAACCAGCTGGAGGCAGG - Intergenic
1158112096 18:53951727-53951749 CTGGGATGCCAGGTGGAGGGAGG - Intergenic
1158505679 18:58044433-58044455 CTGCGGGACCAGCGGGCGGGCGG - Exonic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1158954322 18:62524242-62524264 CAGGGTGACCCGCTGGTGGAAGG - Exonic
1159798161 18:72868013-72868035 CTGGGAGGCGGGCTGGAGGGCGG + Intronic
1159917386 18:74199029-74199051 CCGGGTGAACTGCTGGAGGGAGG + Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160313845 18:77822016-77822038 CTGGGGGCCCAGCTGCAGAGAGG - Intergenic
1160445553 18:78924712-78924734 GTGGGTGACGAGGTGGAGCGAGG + Intergenic
1160686834 19:440806-440828 CTGAGTGACGCACTGGAGGGCGG - Intronic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1160955300 19:1688542-1688564 CTGGGAGACCAGGTGGAGACGGG + Intergenic
1161554613 19:4933615-4933637 CTGGGTGACCAGGCAGAGGAGGG - Intronic
1161815778 19:6498999-6499021 CTGGGTGGCCAGGGGGTGGGAGG + Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162469562 19:10864381-10864403 ATGGGTGACAAGCAGGAGGTGGG + Intronic
1162565902 19:11445820-11445842 CTGGGTTACCTGGTGGAGGGTGG + Intronic
1163187557 19:15649686-15649708 CTGGGTGCCTAGCTGCATGGAGG + Intronic
1163586752 19:18168547-18168569 GTGAGTGACCGTCTGGAGGGAGG + Intronic
1163659727 19:18569451-18569473 CTGGGGGCCCTGCTGGAGGGAGG + Intergenic
1165189538 19:34051116-34051138 CTGGGGGGCCTGCTTGAGGGTGG + Intergenic
1165978351 19:39697263-39697285 CTGGGTGAACATCTGGGGGCTGG + Intergenic
1166288895 19:41849145-41849167 ATGAGTGGGCAGCTGGAGGGAGG - Exonic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166746603 19:45144843-45144865 CTGAGTGTGCGGCTGGAGGGAGG - Exonic
1166783480 19:45354202-45354224 CTGGGTGACCAGCAGGACATGGG - Intronic
1167137707 19:47627253-47627275 ATGGGTGACCAGCTGGAGTCAGG + Intronic
1168326623 19:55541865-55541887 CTGGGAGACCAGCTGGGAGTTGG - Intronic
924963907 2:58157-58179 TGGGATGACCAGCTGCAGGGAGG + Intergenic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925917159 2:8614959-8614981 CTGGATGACCAGGTGAATGGTGG + Intergenic
926195744 2:10762747-10762769 CTGGGTGGCTGGGTGGAGGGAGG - Intronic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
927307899 2:21594976-21594998 CTTGCTGACCAACGGGAGGGAGG - Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927715964 2:25353222-25353244 AGGGGTGGCCAGCTGGAGGGTGG - Intergenic
927928703 2:27030386-27030408 CTGGGAGACCAGTGAGAGGGTGG - Intergenic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929054690 2:37865841-37865863 CTGGGGCCCCAGCTGGAGGGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
930022455 2:47009550-47009572 AGGGGAGGCCAGCTGGAGGGAGG + Intronic
931666366 2:64612209-64612231 CTGGGGGACCAGTTGGGTGGGGG + Intergenic
932582982 2:73004628-73004650 CTGGGAGACCAGAGGGAGTGTGG + Intronic
932763512 2:74455933-74455955 CTGGGTGAGGATCTGGAGGTGGG + Exonic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
936018240 2:108975506-108975528 CTTGGTGACCAGATGGATGCCGG + Intronic
936554952 2:113488037-113488059 CTGGTTGGCCTGCTGCAGGGAGG - Intronic
937152743 2:119697043-119697065 CTGGCTGACCAGCTGCAGGCTGG + Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
938651893 2:133391570-133391592 TTGGGTGACCAGATGGACTGTGG - Intronic
940572408 2:155455147-155455169 CTGGGTGATAAGATTGAGGGTGG + Intergenic
941964990 2:171292187-171292209 CTGGGTGGAGAGCTGGAGGGTGG - Intergenic
941978128 2:171427706-171427728 CAGGGTGATGTGCTGGAGGGTGG - Intronic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
942797872 2:179842696-179842718 TTTGCTGAACAGCTGGAGGGAGG - Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946967746 2:225055791-225055813 CTTGCTTCCCAGCTGGAGGGTGG - Intergenic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948391253 2:237613088-237613110 CTGGGAGACCAGGTGGTGGTTGG - Intergenic
948423720 2:237875490-237875512 GTGGGTGACCCACTGGAGTGAGG + Intronic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
948940210 2:241191528-241191550 GTGGCTGAACAGCTGGAGGATGG - Intronic
1169208455 20:3752888-3752910 ATGGAAGAGCAGCTGGAGGGTGG + Exonic
1170415370 20:16133615-16133637 CTGGGGGAACTGCTGGGGGGAGG + Intergenic
1171882313 20:30627607-30627629 CTGGGTGAACACCCGCAGGGAGG - Intergenic
1172386053 20:34534944-34534966 ATGGGACACCAGCTGGAGGCTGG - Intronic
1172486406 20:35300597-35300619 CTGGCTGACCTGGGGGAGGGAGG + Intergenic
1174288253 20:49487484-49487506 CTGGGTGACCACATAGCGGGTGG - Intergenic
1174547304 20:51334926-51334948 CGGGGTGACCACGTGGATGGTGG + Intergenic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1175064395 20:56272742-56272764 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1178467051 21:32858568-32858590 CAGGATGACCAGCTGTAGAGAGG - Intergenic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1179008030 21:37531645-37531667 AGGGGGGCCCAGCTGGAGGGAGG - Intergenic
1179818142 21:43921210-43921232 CTGACTGACCAGCTACAGGGTGG - Intronic
1180068100 21:45422749-45422771 TTGGGAGACCACCTGGTGGGTGG + Intronic
1180077053 21:45468287-45468309 CTGGGTGACCTGCTGGGGCGGGG - Exonic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180734225 22:18003699-18003721 TGGGGTGACCAGCTGTTGGGAGG - Intronic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1180946454 22:19696337-19696359 CGGCGTGACCAGCTGGATGATGG - Intergenic
1180963482 22:19773522-19773544 CTGGCTGGCCGCCTGGAGGGAGG - Intronic
1181106910 22:20581119-20581141 CTGGGAGACCAGGGGGTGGGGGG - Intronic
1181119723 22:20657798-20657820 GAGGGTGACAAGCAGGAGGGGGG + Intergenic
1181508794 22:23379656-23379678 CGGTGGGAGCAGCTGGAGGGAGG - Intergenic
1181595247 22:23910244-23910266 TTGGGTGAAGAGTTGGAGGGTGG - Intergenic
1181595254 22:23910278-23910300 TTGGGTGAAGAGTTGGAGGGTGG - Intergenic
1181636599 22:24177625-24177647 CTGGGTGACCCTCTGGTGGCTGG - Exonic
1183005704 22:34899962-34899984 CTGGGGGATCAGCTGGAGTTTGG + Intergenic
1183335626 22:37244337-37244359 CTGGCAGAGCAGCTGGTGGGAGG + Intronic
1183398609 22:37587894-37587916 ATGGGTGAGGAGGTGGAGGGAGG + Intergenic
1183470943 22:38006427-38006449 CTGAGTGAGCGGCTGGAGGGTGG - Intronic
1183524102 22:38313786-38313808 CTGGGTCACCAGCTGGGTGTGGG - Intronic
1183621013 22:38972640-38972662 CTGCGAGACCAGGTGGAGAGAGG - Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184350109 22:43937707-43937729 GTGGGTGGACAGGTGGAGGGAGG - Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184765826 22:46571965-46571987 CTGGGTGATAAGCAGGTGGGAGG - Intergenic
949890757 3:8732302-8732324 CCTGGTGGCCAGGTGGAGGGTGG - Intronic
950358114 3:12428690-12428712 GCTGGTGACCAGTTGGAGGGTGG + Intronic
953179341 3:40581894-40581916 CTGTGTGTCCTGCTGCAGGGAGG + Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954155232 3:48681654-48681676 GTGGGTGAGCAGCTGGAGCCTGG + Exonic
954301094 3:49701227-49701249 CTGTGGGACAAGCTGGAGAGAGG - Intronic
954371662 3:50172146-50172168 ATGGGTTACCAGCTGGGGAGGGG + Intronic
954375566 3:50192522-50192544 CTGGTCAACCAGCTGGAGGTGGG + Intronic
955678499 3:61475129-61475151 CTTGCTGACCAGCTGCAGGAGGG + Intergenic
955778823 3:62462340-62462362 CTTGGAGAGGAGCTGGAGGGAGG - Intronic
955906895 3:63816692-63816714 GTGTGTGATAAGCTGGAGGGAGG - Intergenic
956071769 3:65460702-65460724 CTAGGGGACCTGTTGGAGGGTGG - Intronic
956805738 3:72809205-72809227 GTGGGTGACCAGCGGCAGGGAGG - Intronic
960690624 3:120342406-120342428 TGGGGTGACCAGCTGCAGAGAGG + Intronic
960971666 3:123144145-123144167 CCGGGTGCTCAGCTGGAGGCAGG + Intronic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962423569 3:135249458-135249480 CTGGGTGACCAGCTGGAGGGAGG - Exonic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
965365129 3:167788647-167788669 CTGGGTTACCAACTGGTGAGCGG - Intronic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
969471466 4:7391818-7391840 CTGGGTGAGGGGCTGGAAGGAGG - Intronic
969594617 4:8142041-8142063 CTGGGCTTGCAGCTGGAGGGAGG - Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
969714819 4:8863382-8863404 CTGGGTGAGCAGCACCAGGGAGG - Intronic
970309852 4:14770685-14770707 CTAGGTTACCAGCTGGAAAGTGG - Intergenic
971252676 4:24986338-24986360 CCGGGCTAACAGCTGGAGGGAGG - Intergenic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
974282865 4:59822057-59822079 CTGAGTGTTCAGCTGAAGGGAGG - Intergenic
975254329 4:72216111-72216133 CAAGATGACCAGCTGCAGGGAGG - Intergenic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
980007624 4:127559582-127559604 TGGGGTGACCAGCTGCAGAGAGG + Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
985379475 4:189377201-189377223 CTGGATGCTCAGCTGGAGGTAGG + Intergenic
985780364 5:1867763-1867785 GTGGGTGTCCAACTTGAGGGCGG + Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987075679 5:14379944-14379966 GTGGGTGGCCAGCAGGCGGGAGG - Intronic
989173239 5:38494323-38494345 CTGGCTGACCAGGGGTAGGGTGG + Intronic
989379316 5:40798083-40798105 CTGGGTGACACGCTGGGGGTCGG - Exonic
990923450 5:60993702-60993724 CGGGGTGATCAGCTGCAGAGAGG - Intronic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
995106728 5:108383236-108383258 CTTGGTTACCTGCTGAAGGGTGG + Intergenic
997309291 5:132866502-132866524 CTGGGTGACCCGTAGGTGGGAGG - Intronic
997457909 5:134031097-134031119 CTGGATGACCACCTGGTGTGGGG + Intergenic
997812641 5:136987076-136987098 CTGGATGACCATCTCCAGGGAGG + Intronic
998696198 5:144642410-144642432 CTGTGTGACCATCTGTTGGGTGG + Intergenic
998931902 5:147190577-147190599 ATGAGTGACCATGTGGAGGGAGG - Intergenic
999449462 5:151667382-151667404 CTGGGCCCCCAGCTGCAGGGCGG - Intronic
1001563725 5:172686424-172686446 CTGTATGCTCAGCTGGAGGGAGG + Intronic
1001815875 5:174669089-174669111 CCAGGTGACCAGATGGATGGTGG + Intergenic
1002201335 5:177530378-177530400 CTTGGTGACCAGCAAGATGGTGG - Intronic
1002424955 5:179169484-179169506 CTGGGTGAGGAGGTGGATGGAGG + Intronic
1002802886 6:543000-543022 CTGGATGATAAGCTGGAGAGTGG + Intronic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1004870183 6:19896496-19896518 CTGGGTGGACAGCTGGACTGGGG - Intergenic
1005761163 6:28969445-28969467 CTTGGAGAACAGCTTGAGGGAGG - Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006416664 6:33908449-33908471 GTGGTTGACCATCTGGATGGAGG - Intergenic
1006444229 6:34069877-34069899 CTGGGTGGGGAGCTAGAGGGTGG - Intronic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006793895 6:36720352-36720374 CTGGGCCTCCAGCTGCAGGGTGG - Exonic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1010884068 6:81215349-81215371 CGGGATGACCAGCTGCAGGGAGG + Intergenic
1011259734 6:85458408-85458430 CTGGATGACCAGCTTCAGGCAGG + Intronic
1011626530 6:89287698-89287720 CTGAGTCCCCAGCTAGAGGGAGG + Intronic
1012988049 6:105896160-105896182 CAGAGTGTCCAGCTGGAGAGAGG + Intergenic
1013463984 6:110400825-110400847 CTGGGTGCCCAGCTGAAAGAAGG - Intronic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1018447147 6:163868058-163868080 CTGGGTGAGGAGCTGGGGAGGGG + Intergenic
1018956499 6:168413619-168413641 CTGCTTGTCCAGCAGGAGGGAGG + Intergenic
1019539807 7:1546533-1546555 CAGGCTGGGCAGCTGGAGGGAGG - Exonic
1020435854 7:8161616-8161638 TGGGCTGACCAGCTGGAGGGGGG + Intronic
1021043228 7:15889670-15889692 CTGGGTAACCTTCTGGTGGGTGG - Intergenic
1022401274 7:30040566-30040588 GGGGGTGACCAGCTCCAGGGTGG - Intronic
1022471988 7:30687744-30687766 CTGTGCCACCTGCTGGAGGGAGG + Intronic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1022965191 7:35465874-35465896 CCGGGTGACCTGCTGGAAGTGGG - Intergenic
1023845113 7:44116144-44116166 GTTGGTGACCAGCTGGAGCGTGG + Exonic
1023872910 7:44272345-44272367 CTGGGTGCCCAGGAGGAGAGGGG - Intronic
1024558981 7:50627928-50627950 CTGGGAGCCCAGCGGGTGGGTGG - Intronic
1024673736 7:51619885-51619907 ATAGGAGAACAGCTGGAGGGAGG + Intergenic
1026545240 7:71316606-71316628 CCAGCTGACCTGCTGGAGGGAGG + Intronic
1026598272 7:71752447-71752469 CTAGGTCACCTGCTGGAGGAGGG + Intergenic
1028529167 7:91819138-91819160 CTGGGGGAAAAGGTGGAGGGAGG - Intronic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029200648 7:98837052-98837074 CAGAGTGACCAGGTGGAGGTTGG - Intergenic
1029434610 7:100555686-100555708 AGGCTTGACCAGCTGGAGGGAGG - Exonic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1032166788 7:129551604-129551626 CTGGGTGACCTGCTGGATTGTGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033235803 7:139637006-139637028 CTGCCTAAGCAGCTGGAGGGTGG - Intronic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034490808 7:151392260-151392282 CTCGCTGGCCAGCTGGATGGGGG - Intronic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035208318 7:157309413-157309435 CAAGCTGTCCAGCTGGAGGGAGG - Intergenic
1035457246 7:159016592-159016614 CAGGGTGCCAAGCAGGAGGGTGG - Intergenic
1035705086 8:1669253-1669275 CTGGGGGCCCAGATGGACGGCGG - Intronic
1036993658 8:13629810-13629832 CTGGGTGACCCATTGGAGGAAGG + Intergenic
1037766635 8:21776199-21776221 CTGGGTGACCACATGCAGTGGGG - Intronic
1037769605 8:21790624-21790646 CTGGGGGAGAAGATGGAGGGAGG - Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1037890055 8:22619318-22619340 CTGGATCTCCAGCTGCAGGGGGG - Exonic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038416112 8:27397250-27397272 CTGGGTGCCAGGGTGGAGGGAGG + Intronic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1039058983 8:33558567-33558589 GTGGGAGTCCAGCAGGAGGGAGG - Intronic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1042169484 8:65978011-65978033 CTGGGTCAGCAGCTGCAGAGGGG - Intergenic
1045328748 8:101137285-101137307 CTTCCTGCCCAGCTGGAGGGAGG + Intergenic
1046857071 8:119044601-119044623 TTGGGAGGCCAGCGGGAGGGCGG + Intronic
1047252683 8:123192600-123192622 CTGGGTGAACAGCTGATTGGTGG + Intronic
1048338129 8:133518197-133518219 AGGGCTGACCAGCTTGAGGGTGG + Intronic
1048443832 8:134478713-134478735 CTCGGTGACCTGCGGGAGGAGGG + Exonic
1048879421 8:138860352-138860374 CAGGGTGACCACCTGGAGTGAGG - Intronic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1049578637 8:143400903-143400925 CTGGGTGTGCAGCTGGGTGGGGG + Intergenic
1049745936 8:144263348-144263370 CTGGGGGACCGGCTGGTGGCGGG - Exonic
1049784271 8:144443134-144443156 GTGGATGAGGAGCTGGAGGGTGG - Exonic
1049898054 9:129147-129169 CTGGTTGGCCTGCTGCAGGGAGG + Intronic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053741132 9:41139445-41139467 CTGGTTGGCCTGCTGCAGGGAGG + Intronic
1054346342 9:63968934-63968956 CTGGTTGGCCTGCTGCAGGGAGG + Intergenic
1054444118 9:65295584-65295606 CTGGTTGGCCTGCTGCAGGGAGG + Intergenic
1054486154 9:65725921-65725943 CTGGTTGGCCTGCTGCAGGGAGG - Intronic
1054687217 9:68291852-68291874 CTGGTTGGCCTGCTGCAGGGAGG - Intronic
1055469533 9:76597612-76597634 GTGGGTGGACAGCTTGAGGGGGG - Intergenic
1056658931 9:88530843-88530865 CTGGGGGCCCAGGTGGTGGGGGG - Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1056831433 9:89920305-89920327 CTGGGAGGCCAGGTGGAGGGTGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1058510804 9:105713948-105713970 GGGGATGACCAGCTGCAGGGAGG + Intronic
1058743637 9:107968446-107968468 CTGTGTGTCCAGTTGGAGGGAGG + Intergenic
1058814243 9:108668805-108668827 CTGGGTGAGCAGCTGATGGGAGG - Intergenic
1060947561 9:127579144-127579166 CTGAGTCACCAGCTGGTGAGGGG - Intergenic
1060994430 9:127868101-127868123 CTGAGTCACCAGGTGGAGTGGGG + Intronic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1062618479 9:137408606-137408628 CTTGCTGAGCAGCTGGGGGGAGG - Intronic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1189331836 X:40148915-40148937 CTGGGTGAGCATCTGCATGGAGG + Intronic
1190416351 X:50184032-50184054 CTGGGTGCCCAGTAGGTGGGAGG + Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1197609520 X:128623091-128623113 CTGGGTGGCCAGCTGCAGAGAGG - Intergenic
1199683393 X:150242979-150243001 CTGGGAGACAGGCAGGAGGGAGG + Intergenic
1201076716 Y:10195242-10195264 CTGAGGGATAAGCTGGAGGGGGG - Intergenic