ID: 962426097

View in Genome Browser
Species Human (GRCh38)
Location 3:135270654-135270676
Sequence CAGCAACATGGGCCCTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962426097_962426104 16 Left 962426097 3:135270654-135270676 CCACACCAGGGCCCATGTTGCTG No data
Right 962426104 3:135270693-135270715 CTTGATGACCAGACCCTGCCTGG No data
962426097_962426106 28 Left 962426097 3:135270654-135270676 CCACACCAGGGCCCATGTTGCTG No data
Right 962426106 3:135270705-135270727 ACCCTGCCTGGTCCCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962426097 Original CRISPR CAGCAACATGGGCCCTGGTG TGG (reversed) Intergenic
No off target data available for this crispr