ID: 962429889

View in Genome Browser
Species Human (GRCh38)
Location 3:135309277-135309299
Sequence ATTATGGAGGGCATAATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962429884_962429889 0 Left 962429884 3:135309254-135309276 CCTGCTCTCTATTCTTCTGCTAG No data
Right 962429889 3:135309277-135309299 ATTATGGAGGGCATAATCCAGGG No data
962429883_962429889 5 Left 962429883 3:135309249-135309271 CCATTCCTGCTCTCTATTCTTCT No data
Right 962429889 3:135309277-135309299 ATTATGGAGGGCATAATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962429889 Original CRISPR ATTATGGAGGGCATAATCCA GGG Intergenic
No off target data available for this crispr