ID: 962430729

View in Genome Browser
Species Human (GRCh38)
Location 3:135317098-135317120
Sequence GGAGCTTCCTTAGATTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962430729_962430734 21 Left 962430729 3:135317098-135317120 CCTTTGAAATCTAAGGAAGCTCC No data
Right 962430734 3:135317142-135317164 TAGTAGATGGTGCAAGGTATAGG No data
962430729_962430733 15 Left 962430729 3:135317098-135317120 CCTTTGAAATCTAAGGAAGCTCC No data
Right 962430733 3:135317136-135317158 TCTTAGTAGTAGATGGTGCAAGG No data
962430729_962430731 8 Left 962430729 3:135317098-135317120 CCTTTGAAATCTAAGGAAGCTCC No data
Right 962430731 3:135317129-135317151 TTCTTCCTCTTAGTAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962430729 Original CRISPR GGAGCTTCCTTAGATTTCAA AGG (reversed) Intergenic
No off target data available for this crispr