ID: 962430730

View in Genome Browser
Species Human (GRCh38)
Location 3:135317119-135317141
Sequence CTAAGAGGAAGAAACATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962430730_962430734 0 Left 962430730 3:135317119-135317141 CCTCAAATGTTTCTTCCTCTTAG No data
Right 962430734 3:135317142-135317164 TAGTAGATGGTGCAAGGTATAGG No data
962430730_962430736 23 Left 962430730 3:135317119-135317141 CCTCAAATGTTTCTTCCTCTTAG No data
Right 962430736 3:135317165-135317187 AACTTCTCTTTCACATTGAAGGG No data
962430730_962430735 22 Left 962430730 3:135317119-135317141 CCTCAAATGTTTCTTCCTCTTAG No data
Right 962430735 3:135317164-135317186 GAACTTCTCTTTCACATTGAAGG No data
962430730_962430733 -6 Left 962430730 3:135317119-135317141 CCTCAAATGTTTCTTCCTCTTAG No data
Right 962430733 3:135317136-135317158 TCTTAGTAGTAGATGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962430730 Original CRISPR CTAAGAGGAAGAAACATTTG AGG (reversed) Intergenic
No off target data available for this crispr