ID: 962430733 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:135317136-135317158 |
Sequence | TCTTAGTAGTAGATGGTGCA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
962430730_962430733 | -6 | Left | 962430730 | 3:135317119-135317141 | CCTCAAATGTTTCTTCCTCTTAG | No data | ||
Right | 962430733 | 3:135317136-135317158 | TCTTAGTAGTAGATGGTGCAAGG | No data | ||||
962430729_962430733 | 15 | Left | 962430729 | 3:135317098-135317120 | CCTTTGAAATCTAAGGAAGCTCC | No data | ||
Right | 962430733 | 3:135317136-135317158 | TCTTAGTAGTAGATGGTGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
962430733 | Original CRISPR | TCTTAGTAGTAGATGGTGCA AGG | Intergenic | ||
No off target data available for this crispr |