ID: 962430733

View in Genome Browser
Species Human (GRCh38)
Location 3:135317136-135317158
Sequence TCTTAGTAGTAGATGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962430730_962430733 -6 Left 962430730 3:135317119-135317141 CCTCAAATGTTTCTTCCTCTTAG No data
Right 962430733 3:135317136-135317158 TCTTAGTAGTAGATGGTGCAAGG No data
962430729_962430733 15 Left 962430729 3:135317098-135317120 CCTTTGAAATCTAAGGAAGCTCC No data
Right 962430733 3:135317136-135317158 TCTTAGTAGTAGATGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962430733 Original CRISPR TCTTAGTAGTAGATGGTGCA AGG Intergenic
No off target data available for this crispr