ID: 962433575

View in Genome Browser
Species Human (GRCh38)
Location 3:135344234-135344256
Sequence AGTCAAGGTAAAGAACCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962433573_962433575 -3 Left 962433573 3:135344214-135344236 CCAACACAAATCATGTCTGGAGT No data
Right 962433575 3:135344234-135344256 AGTCAAGGTAAAGAACCAACAGG No data
962433571_962433575 30 Left 962433571 3:135344181-135344203 CCACTAAAGTAGCTCTAGATAGT No data
Right 962433575 3:135344234-135344256 AGTCAAGGTAAAGAACCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962433575 Original CRISPR AGTCAAGGTAAAGAACCAAC AGG Intergenic
No off target data available for this crispr