ID: 962433678

View in Genome Browser
Species Human (GRCh38)
Location 3:135345375-135345397
Sequence CTGAGAGCAGAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962433673_962433678 1 Left 962433673 3:135345351-135345373 CCCAATTACCTCTTCTGATGTTA No data
Right 962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG No data
962433672_962433678 29 Left 962433672 3:135345323-135345345 CCAAAAAAGCTTCTTTGGTCTAT No data
Right 962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG No data
962433675_962433678 -7 Left 962433675 3:135345359-135345381 CCTCTTCTGATGTTAGCTGAGAG No data
Right 962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG No data
962433674_962433678 0 Left 962433674 3:135345352-135345374 CCAATTACCTCTTCTGATGTTAG No data
Right 962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962433678 Original CRISPR CTGAGAGCAGAGAAGGAGGA TGG Intergenic
No off target data available for this crispr