ID: 962433776

View in Genome Browser
Species Human (GRCh38)
Location 3:135346170-135346192
Sequence ACCACACAAGTCCCAAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962433776_962433779 17 Left 962433776 3:135346170-135346192 CCCAGTCTTGGGACTTGTGTGGT No data
Right 962433779 3:135346210-135346232 GCTTCCTCTGTGCTATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962433776 Original CRISPR ACCACACAAGTCCCAAGACT GGG (reversed) Intergenic
No off target data available for this crispr