ID: 962433779

View in Genome Browser
Species Human (GRCh38)
Location 3:135346210-135346232
Sequence GCTTCCTCTGTGCTATAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962433777_962433779 16 Left 962433777 3:135346171-135346193 CCAGTCTTGGGACTTGTGTGGTC No data
Right 962433779 3:135346210-135346232 GCTTCCTCTGTGCTATAGTTTGG No data
962433773_962433779 25 Left 962433773 3:135346162-135346184 CCCAGTATCCCAGTCTTGGGACT No data
Right 962433779 3:135346210-135346232 GCTTCCTCTGTGCTATAGTTTGG No data
962433774_962433779 24 Left 962433774 3:135346163-135346185 CCAGTATCCCAGTCTTGGGACTT No data
Right 962433779 3:135346210-135346232 GCTTCCTCTGTGCTATAGTTTGG No data
962433776_962433779 17 Left 962433776 3:135346170-135346192 CCCAGTCTTGGGACTTGTGTGGT No data
Right 962433779 3:135346210-135346232 GCTTCCTCTGTGCTATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962433779 Original CRISPR GCTTCCTCTGTGCTATAGTT TGG Intergenic
No off target data available for this crispr