ID: 962434126

View in Genome Browser
Species Human (GRCh38)
Location 3:135348833-135348855
Sequence CTCTTGGTTGTGTAAGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962434126_962434132 -5 Left 962434126 3:135348833-135348855 CCACAGACTTACACAACCAAGAG No data
Right 962434132 3:135348851-135348873 AAGAGGGAGGGAAACAAGCTAGG No data
962434126_962434136 23 Left 962434126 3:135348833-135348855 CCACAGACTTACACAACCAAGAG No data
Right 962434136 3:135348879-135348901 CTTGATAACACTGTGCCAGATGG No data
962434126_962434138 25 Left 962434126 3:135348833-135348855 CCACAGACTTACACAACCAAGAG No data
Right 962434138 3:135348881-135348903 TGATAACACTGTGCCAGATGGGG No data
962434126_962434137 24 Left 962434126 3:135348833-135348855 CCACAGACTTACACAACCAAGAG No data
Right 962434137 3:135348880-135348902 TTGATAACACTGTGCCAGATGGG No data
962434126_962434133 -4 Left 962434126 3:135348833-135348855 CCACAGACTTACACAACCAAGAG No data
Right 962434133 3:135348852-135348874 AGAGGGAGGGAAACAAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962434126 Original CRISPR CTCTTGGTTGTGTAAGTCTG TGG (reversed) Intergenic
No off target data available for this crispr