ID: 962434953

View in Genome Browser
Species Human (GRCh38)
Location 3:135357644-135357666
Sequence GGCAAGATAATTCATCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962434953_962434958 21 Left 962434953 3:135357644-135357666 CCCTTAAGATGAATTATCTTGCC No data
Right 962434958 3:135357688-135357710 GCCCCCTAACTTCTCACACTAGG No data
962434953_962434963 29 Left 962434953 3:135357644-135357666 CCCTTAAGATGAATTATCTTGCC No data
Right 962434963 3:135357696-135357718 ACTTCTCACACTAGGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962434953 Original CRISPR GGCAAGATAATTCATCTTAA GGG (reversed) Intergenic
No off target data available for this crispr