ID: 962437871

View in Genome Browser
Species Human (GRCh38)
Location 3:135383149-135383171
Sequence CAGGGAGAATGCAGGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962437860_962437871 20 Left 962437860 3:135383106-135383128 CCTCCTGGGACCCTTGAAGAAGG No data
Right 962437871 3:135383149-135383171 CAGGGAGAATGCAGGGCGGAAGG No data
962437864_962437871 10 Left 962437864 3:135383116-135383138 CCCTTGAAGAAGGCAGGATGCAT No data
Right 962437871 3:135383149-135383171 CAGGGAGAATGCAGGGCGGAAGG No data
962437862_962437871 17 Left 962437862 3:135383109-135383131 CCTGGGACCCTTGAAGAAGGCAG No data
Right 962437871 3:135383149-135383171 CAGGGAGAATGCAGGGCGGAAGG No data
962437865_962437871 9 Left 962437865 3:135383117-135383139 CCTTGAAGAAGGCAGGATGCATG No data
Right 962437871 3:135383149-135383171 CAGGGAGAATGCAGGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962437871 Original CRISPR CAGGGAGAATGCAGGGCGGA AGG Intergenic
No off target data available for this crispr