ID: 962440878

View in Genome Browser
Species Human (GRCh38)
Location 3:135415149-135415171
Sequence ACTGCTCTGCAGAGGGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962440868_962440878 25 Left 962440868 3:135415101-135415123 CCAGGAGCAATGAAAATGGCTCA No data
Right 962440878 3:135415149-135415171 ACTGCTCTGCAGAGGGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962440878 Original CRISPR ACTGCTCTGCAGAGGGTTGG TGG Intergenic
No off target data available for this crispr