ID: 962456170

View in Genome Browser
Species Human (GRCh38)
Location 3:135567496-135567518
Sequence GACACGTGCTCTCCCTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962456170_962456175 6 Left 962456170 3:135567496-135567518 CCATGTGAGGGAGAGCACGTGTC No data
Right 962456175 3:135567525-135567547 GGGAAAGACAAGCGAGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962456170 Original CRISPR GACACGTGCTCTCCCTCACA TGG (reversed) Intergenic
No off target data available for this crispr