ID: 962461939

View in Genome Browser
Species Human (GRCh38)
Location 3:135622123-135622145
Sequence TAGGCAGAATGTCTGTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962461939_962461946 15 Left 962461939 3:135622123-135622145 CCAAAGGACAGACATTCTGCCTA No data
Right 962461946 3:135622161-135622183 CCCACCCAGTACTGGGCACATGG No data
962461939_962461942 7 Left 962461939 3:135622123-135622145 CCAAAGGACAGACATTCTGCCTA No data
Right 962461942 3:135622153-135622175 TCCATATTCCCACCCAGTACTGG No data
962461939_962461944 8 Left 962461939 3:135622123-135622145 CCAAAGGACAGACATTCTGCCTA No data
Right 962461944 3:135622154-135622176 CCATATTCCCACCCAGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962461939 Original CRISPR TAGGCAGAATGTCTGTCCTT TGG (reversed) Intergenic
No off target data available for this crispr