ID: 962462270

View in Genome Browser
Species Human (GRCh38)
Location 3:135625425-135625447
Sequence CTGCATTTTTAGCTGATTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962462267_962462270 -2 Left 962462267 3:135625404-135625426 CCTGGGTCAAAGAGGAGGTGCCT No data
Right 962462270 3:135625425-135625447 CTGCATTTTTAGCTGATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962462270 Original CRISPR CTGCATTTTTAGCTGATTAA GGG Intergenic
No off target data available for this crispr