ID: 962462335

View in Genome Browser
Species Human (GRCh38)
Location 3:135625778-135625800
Sequence GCCCCCCAAACAAAAACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962462335_962462337 -2 Left 962462335 3:135625778-135625800 CCCTGTGTTTTTGTTTGGGGGGC No data
Right 962462337 3:135625799-135625821 GCCTTGTAAAATGATGTAACTGG No data
962462335_962462342 30 Left 962462335 3:135625778-135625800 CCCTGTGTTTTTGTTTGGGGGGC No data
Right 962462342 3:135625831-135625853 CAGTACAGTACAGGGAAGTAGGG No data
962462335_962462339 21 Left 962462335 3:135625778-135625800 CCCTGTGTTTTTGTTTGGGGGGC No data
Right 962462339 3:135625822-135625844 TTCTGTTTACAGTACAGTACAGG No data
962462335_962462341 29 Left 962462335 3:135625778-135625800 CCCTGTGTTTTTGTTTGGGGGGC No data
Right 962462341 3:135625830-135625852 ACAGTACAGTACAGGGAAGTAGG No data
962462335_962462340 22 Left 962462335 3:135625778-135625800 CCCTGTGTTTTTGTTTGGGGGGC No data
Right 962462340 3:135625823-135625845 TCTGTTTACAGTACAGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962462335 Original CRISPR GCCCCCCAAACAAAAACACA GGG (reversed) Intergenic
No off target data available for this crispr