ID: 962462816

View in Genome Browser
Species Human (GRCh38)
Location 3:135630341-135630363
Sequence CAAAATGGACACTTTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962462816_962462820 4 Left 962462816 3:135630341-135630363 CCTCCATCAAAGTGTCCATTTTG No data
Right 962462820 3:135630368-135630390 CCAACTCAAAGATATGAAAATGG No data
962462816_962462821 27 Left 962462816 3:135630341-135630363 CCTCCATCAAAGTGTCCATTTTG No data
Right 962462821 3:135630391-135630413 CTCCCTTGAACACTGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962462816 Original CRISPR CAAAATGGACACTTTGATGG AGG (reversed) Intergenic
No off target data available for this crispr