ID: 962470074

View in Genome Browser
Species Human (GRCh38)
Location 3:135699004-135699026
Sequence ACCATATGTGAGATGGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962470074_962470082 22 Left 962470074 3:135699004-135699026 CCATTGCCCATCTCACATATGGT No data
Right 962470082 3:135699049-135699071 GATGTTCTTGAGGCAGGGCAAGG No data
962470074_962470081 17 Left 962470074 3:135699004-135699026 CCATTGCCCATCTCACATATGGT No data
Right 962470081 3:135699044-135699066 AAGGAGATGTTCTTGAGGCAGGG No data
962470074_962470080 16 Left 962470074 3:135699004-135699026 CCATTGCCCATCTCACATATGGT No data
Right 962470080 3:135699043-135699065 TAAGGAGATGTTCTTGAGGCAGG No data
962470074_962470078 -2 Left 962470074 3:135699004-135699026 CCATTGCCCATCTCACATATGGT No data
Right 962470078 3:135699025-135699047 GTTGTGGAGAGCAGTACATAAGG No data
962470074_962470079 12 Left 962470074 3:135699004-135699026 CCATTGCCCATCTCACATATGGT No data
Right 962470079 3:135699039-135699061 TACATAAGGAGATGTTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962470074 Original CRISPR ACCATATGTGAGATGGGCAA TGG (reversed) Intergenic
No off target data available for this crispr