ID: 962470076

View in Genome Browser
Species Human (GRCh38)
Location 3:135699010-135699032
Sequence TCCACAACCATATGTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962470076_962470078 -8 Left 962470076 3:135699010-135699032 CCCATCTCACATATGGTTGTGGA No data
Right 962470078 3:135699025-135699047 GTTGTGGAGAGCAGTACATAAGG No data
962470076_962470079 6 Left 962470076 3:135699010-135699032 CCCATCTCACATATGGTTGTGGA No data
Right 962470079 3:135699039-135699061 TACATAAGGAGATGTTCTTGAGG No data
962470076_962470081 11 Left 962470076 3:135699010-135699032 CCCATCTCACATATGGTTGTGGA No data
Right 962470081 3:135699044-135699066 AAGGAGATGTTCTTGAGGCAGGG No data
962470076_962470083 29 Left 962470076 3:135699010-135699032 CCCATCTCACATATGGTTGTGGA No data
Right 962470083 3:135699062-135699084 CAGGGCAAGGCCAACCATCTTGG No data
962470076_962470082 16 Left 962470076 3:135699010-135699032 CCCATCTCACATATGGTTGTGGA No data
Right 962470082 3:135699049-135699071 GATGTTCTTGAGGCAGGGCAAGG No data
962470076_962470080 10 Left 962470076 3:135699010-135699032 CCCATCTCACATATGGTTGTGGA No data
Right 962470080 3:135699043-135699065 TAAGGAGATGTTCTTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962470076 Original CRISPR TCCACAACCATATGTGAGAT GGG (reversed) Intergenic
No off target data available for this crispr