ID: 962470082

View in Genome Browser
Species Human (GRCh38)
Location 3:135699049-135699071
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962470072_962470082 23 Left 962470072 3:135699003-135699025 CCCATTGCCCATCTCACATATGG No data
Right 962470082 3:135699049-135699071 GATGTTCTTGAGGCAGGGCAAGG No data
962470074_962470082 22 Left 962470074 3:135699004-135699026 CCATTGCCCATCTCACATATGGT No data
Right 962470082 3:135699049-135699071 GATGTTCTTGAGGCAGGGCAAGG No data
962470077_962470082 15 Left 962470077 3:135699011-135699033 CCATCTCACATATGGTTGTGGAG No data
Right 962470082 3:135699049-135699071 GATGTTCTTGAGGCAGGGCAAGG No data
962470076_962470082 16 Left 962470076 3:135699010-135699032 CCCATCTCACATATGGTTGTGGA No data
Right 962470082 3:135699049-135699071 GATGTTCTTGAGGCAGGGCAAGG No data
962470071_962470082 24 Left 962470071 3:135699002-135699024 CCCCATTGCCCATCTCACATATG No data
Right 962470082 3:135699049-135699071 GATGTTCTTGAGGCAGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr