ID: 962472406

View in Genome Browser
Species Human (GRCh38)
Location 3:135723179-135723201
Sequence CAGTAGAGCTGGAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962472399_962472406 6 Left 962472399 3:135723150-135723172 CCTACCCTATCCCGGATGAACTA No data
Right 962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG No data
962472402_962472406 -4 Left 962472402 3:135723160-135723182 CCCGGATGAACTACTGCACCAGT No data
Right 962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG No data
962472400_962472406 2 Left 962472400 3:135723154-135723176 CCCTATCCCGGATGAACTACTGC No data
Right 962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG No data
962472403_962472406 -5 Left 962472403 3:135723161-135723183 CCGGATGAACTACTGCACCAGTA No data
Right 962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG No data
962472398_962472406 11 Left 962472398 3:135723145-135723167 CCTTTCCTACCCTATCCCGGATG No data
Right 962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG No data
962472401_962472406 1 Left 962472401 3:135723155-135723177 CCTATCCCGGATGAACTACTGCA No data
Right 962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962472406 Original CRISPR CAGTAGAGCTGGAGTGAAGA TGG Intergenic
No off target data available for this crispr