ID: 962473956

View in Genome Browser
Species Human (GRCh38)
Location 3:135739727-135739749
Sequence ATTCAAATGCATAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962473956_962473960 -1 Left 962473956 3:135739727-135739749 CCCTCCACTTTATGCATTTGAAT No data
Right 962473960 3:135739749-135739771 TTAAGGCACTCCAGAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962473956 Original CRISPR ATTCAAATGCATAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr