ID: 962476714

View in Genome Browser
Species Human (GRCh38)
Location 3:135761345-135761367
Sequence CCCTTTCCTGCTCATAGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962476714_962476718 -3 Left 962476714 3:135761345-135761367 CCTAAACTATGAGCAGGAAAGGG No data
Right 962476718 3:135761365-135761387 GGGCTTTGAACTATATGATGGGG No data
962476714_962476717 -4 Left 962476714 3:135761345-135761367 CCTAAACTATGAGCAGGAAAGGG No data
Right 962476717 3:135761364-135761386 AGGGCTTTGAACTATATGATGGG No data
962476714_962476716 -5 Left 962476714 3:135761345-135761367 CCTAAACTATGAGCAGGAAAGGG No data
Right 962476716 3:135761363-135761385 AAGGGCTTTGAACTATATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962476714 Original CRISPR CCCTTTCCTGCTCATAGTTT AGG (reversed) Intergenic
No off target data available for this crispr